The messenger RNA expression values were obtained from the RNA sequencing performed on the hESC-RGC.12 (link) Briefly, the BRN3B-H9 reporter hESCs were differentiated to RGCs for 40 days on neural induction media.12 (link) On day 40 of differentiation, two independent batches of BRN3B-tdTomato+ RGCs were purified using magnetic activated cell sorting.12 (link) RNA was extracted from the purified RGC population using RNAeasy plus kit (Qiagen, Hilden, Germany). Complementary DNA synthesis was performed using SuperScript III Synthesis SuperMix (Thermo Fischer Scientific), and a complementary library was prepared using the Nextera DNA Library Preparation Kit (Illumina, San Diego, CA). Libraries were then multiplexed and sequenced on an Illumina MiSeq with 76 bp paired end reads to an average depth of approximately 8 million paired end reads per sample. Reads were aligned to Gencode Release 24 (GRCh38.p5) using HISAT2 (v2.0.1-beta).29 (link) Cuffquant and Cuffnorm (Cufflinks v2.2.1) were used to quantify expression levels and to calculate normalized fragments per kilobase million values.30 (link)
Rnaeasy plus kit
Manufactured by Qiagen
Sourced in Germany, United States
The RNeasy Plus kit is a RNA isolation and purification product designed to efficiently extract and purify total RNA from a variety of sample types. The kit utilizes a silica-membrane based technology to bind and concentrate RNA, while removing contaminants and inhibitors. The kit provides a reliable and consistent method for obtaining high-quality total RNA suitable for downstream molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (7 mentions)
Iscript cdna synthesis kit, by Bio-Rad (5 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (3 mentions)
Novaseq 6000, by Illumina (3 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (3 mentions)
Qiashredder column, by Qiagen (3 mentions)
Qiashredder, by Qiagen (3 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (3 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Truseq rna sample prep kit v2, by Illumina (2 mentions)
Hiseq 4000 system, by Illumina (2 mentions)
Taqman gene specific primer 6 carboxyfluorescein fam mgb probe mixes, by Thermo Fisher Scientific (2 mentions)
Taqman reverse transcription reagent kit, by Thermo Fisher Scientific (2 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (2 mentions)
Quantasoft analysis software, by Bio-Rad (2 mentions)
Qx100 droplet digital pcr system, by Bio-Rad (2 mentions)
Iscript cdna library kit, by Bio-Rad (2 mentions)
69 protocols using rnaeasy plus kit
1
RNA-seq Analysis of Purified hESC-derived RGCs
2
Virus Inoculation and Transcriptome Analysis in LA4 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Our experimental approach was to inoculate LA4 cells with the three viruses at times t = 0 h and t = 12 h and harvest RNA for microarray analysis at t = 24 h. Controls were mock-inoculated at both time points. Preliminary experiments were done to establish the growth kinetics of each virus and determine a multiplicity of infection (MOI) that resulted in comparable numbers of cells positive for viral antigen at 24 h post-infection (S1 Fig ). Based on this, LA4 cells were inoculated with 3 TCID50/cell RV, 1 PFU/cell PR8, or 3 PFU/cell MHV. Triplicate wells of LA4 cells in 6-well plates were inoculated with each virus diluted in serum-free medium or were mock-inoculated with serum-free medium for 1 h at 37°C. Viral inocula were removed and the cells were rinsed twice with serum-free medium. The cells were incubated in Ham's F12K medium with 2% FBS until the 24 h time point at which time RNA was isolated from cell cultures using an RNAeasy Plus kit (QIAGEN) and transcript levels were measured by microarray (NimbleGen Mus musculus MM9 Expression Array). For the 24 h samples, the media were removed and replaced with fresh media 12 h after inoculation, which is the same time that 12 h samples were inoculated. Raw and processed data are available from NCBI Gene Expression Omnibus under accession number GSE89190.
3
RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from RNAp preserved blood samples using the Qiagen RNAeasy Plus kit that includes a gDNA eliminator column (Qiagen, Germany) per the manufacturer’s instructions. After determination of the RNA concentration using a NanoDrop ND spectrophotometer (Thermo Fisher Scientific Inc, USA), the isolated nucleic acid was treated to remove residual DNA with a DNA-free kit (Ambion, Life Technologies, USA). The treated RNA was then transcribed to cDNA with the QuantiTect Reverse Transcription Kit (Qiagen, Germany) following the manufacturer’s instructions.
4
Transcriptome Analysis of Melanoma Cells
5
Quantitative RT-PCR Protocol for Gene Expression
6
RNA-Seq Analysis of Synergistic Cell Lines
7
RNA Isolation and RNA-Seq Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An RNA easy® Plus Kit (74134, Qiagen, Hilden, Germany) was used to isolate RNA following the manufacturer’s instructions. The RNA quality control was performed as well as library preparation through TruSeqHT Stranded mRNA (Illumina). An Illumina HiSeq 4000 System using the 100 bp single-end reads protocol was applied for the sequencing experiments. A quality control was added with FastQC v.0.11.5. The reads were aligned to the human genome (UCSC hg38) using STAR v.2.5.3a software [45 (link)]. With PicardTools v.2.9.0, the biological quality control was incorporated and the HTSeq v.0.9.1 was utilized for raw count acquisition [45 (link)]. Normalization and differential expression analysis were performed using the R/Bioconductor package edgeR v.3.24.3 [46 (link)]. A general linear model, negative binomial distribution, and quasi-likelihood F test were applied to assed the statistical significance. Genes with a fold change >2 and p-value < 0.05 (with a false discovery rate of 5%) were considered differentially expressed.
Genes up- and downregulated after ODC treatment were analyzed according to the gene ontology enrichment analysis in Enrichr [47 ]. The RNA-Seq data have been deposited in the NCBI Gene Expression Omnibus [48 ] with GEO Series accession GSE174740.
Genes up- and downregulated after ODC treatment were analyzed according to the gene ontology enrichment analysis in Enrichr [47 ]. The RNA-Seq data have been deposited in the NCBI Gene Expression Omnibus [48 ] with GEO Series accession GSE174740.
8
RNA Extraction and qPCR Analysis of Larval Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from five larvae (third instar) with the Qiagen RNA Easy Plus kit (Cat No. 74134). cDNA was produced using the BioRad iScript cDNA synthesis kit (Cat No. 170-8891). qPCR data were generated using the BioRad Ssofast Evagreen Supermix (Cat. No. 175-5211) and the Illumina Eco qPCR system. qPCR primers used were as follows:
Fur1 forward: 5′- AGGAATATGCAGCAGGTGGG -3′, Fur1 reverse: 5′- TGCACTCTAAGCACTTGCGA -3′; tubulin control forward: 5′- TGTCGCGTGTGAAACACTTC -3′, tubulin control reverse: AGCAGGCGTTTCCAATCTG -3′; dLrrke03680 forward: 5′- AGATCAACCCCTTTGCTCCT -3′, dLrrke03680 reverse: 5′- AGCTTAACCGTGCTTCCTGA -3′; dLrrkex1 mutation forward: 5′- AGACAATGTTCCGCTGATCG -3′, dLrrkex1 mutation reverse: 5′- CAGAGCTCTTGGTGGATGACT -3′; GluRIIA forward: 5′- TTCAATCCCTCGGCCTTCAC -3′, GluRIIA reverse: 5′- GTCCGGTAATCAGAGCCCAG -3′; GluRIID forward: 5′- TACTCGAATACCAGAGGACGGA -3′, GluRIID reverse: 5′- TGATGAGGCCCAGGCGAATG -3′; GluRIIE forward: 5′- CCATAGGTCTGCTCACCGAC -3′, GluRIIE reverse: 5′- CAGCGATGCCAGTCTCTAGC -3′
Fur1 forward: 5′- AGGAATATGCAGCAGGTGGG -3′, Fur1 reverse: 5′- TGCACTCTAAGCACTTGCGA -3′; tubulin control forward: 5′- TGTCGCGTGTGAAACACTTC -3′, tubulin control reverse: AGCAGGCGTTTCCAATCTG -3′; dLrrke03680 forward: 5′- AGATCAACCCCTTTGCTCCT -3′, dLrrke03680 reverse: 5′- AGCTTAACCGTGCTTCCTGA -3′; dLrrkex1 mutation forward: 5′- AGACAATGTTCCGCTGATCG -3′, dLrrkex1 mutation reverse: 5′- CAGAGCTCTTGGTGGATGACT -3′; GluRIIA forward: 5′- TTCAATCCCTCGGCCTTCAC -3′, GluRIIA reverse: 5′- GTCCGGTAATCAGAGCCCAG -3′; GluRIID forward: 5′- TACTCGAATACCAGAGGACGGA -3′, GluRIID reverse: 5′- TGATGAGGCCCAGGCGAATG -3′; GluRIIE forward: 5′- CCATAGGTCTGCTCACCGAC -3′, GluRIIE reverse: 5′- CAGCGATGCCAGTCTCTAGC -3′
9
Quantifying mRNA Expression in HFt Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 1.5 × 105 or 2 × 105 HFt cells seeded in 12-well plates were incubated at 37°C in 5% CO2 overnight or at least 4 h before further manipulation. Total RNA was isolated using the RNAeasy Plus kit (Qiagen; 74134) or TRIzol reagent (Invitrogen; 15596) according to the manufacturer's instructions. RNA was reverse transcribed using the TaqMan reverse transcription reagent kit (Life Technologies; N8080234) with oligo(dT) primers. Samples were analyzed in triplicate using TaqMan Fast Universal PCR master mix (Life Technologies; 4352042) with the following TaqMan gene-specific primer (6-carboxyfluorescein [FAM]/MGB)-probe mixes (Life Technologies): PML (assay ID Hs00231241_m1), PIAS4 (assay ID Hs00249203_m1), 18S (GenBank accession number X03205.1 ; Thermo Fisher Scientific; 4319413E), or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; GenBank accession number NM_002046.5 ; Thermo Fisher Scientific; 4333764F).
10
Evaluating Cellular Stress Responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using RNAeasy plus kit (Qiagen). cDNA was generated by using a reverse transcriptase kit (Promega). Cells were lysed by using M-PER mammalian protein extraction reagent and NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific). Protein levels were determined by Western blot using the antibodies as listed: rabbit anti-ATF6α (ab37149, Abcam), rabbit anti-phospho-eIF2α (3597; Cell Signaling Technology), mouse anti-eIF2α (2103; Cell Signaling Technology), and mouse-anti-GRP78 antibody (sc-166490; Santa Cruz Biotechnology).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!