Eight paraffin-embedded samples from HCC patients were investigated. The reseach project was authorized by the ethical committee of the Medical University of Graz (Ref. Nr. 20-119 ex 08/09). CISH was performed using the miCURY LNATM microRNA ISH Optimization Kit (FFPE) (Exiqon, Vedbaek, Denmark) according to manufacturer’s instruction. A biotin-labeled probe was used for the detection of H19 RNA (/5BioTEG/GTCCTGTAACCAAAAGTGACCG, Exiqon, Vedbaek, Denmark). A digoxin-labeled probe of scrambled RNA served as negative control (/5DigN/GTGTAACACGTCTATACGCCCA, Exiqon, Vedbaek, Denmark) and a digoxin-labeled beta-actin probe was used as positive control (/5DigN/CTCATTGTAGAAGGTGTGGTGCCA, Exiqon, Vedbaek, Denmark). All probes were used in a concentration of 40 nM. Proteinase K digestion was done for 10 min at 37°C with 15 µg/ml Proteinase K (Roche, Mannheim, Germany). The hybridization step was performed at 56°C for 1 h in a slide hybridizer DakoCytomation (Dako, Hamburg, Germany). Nuclei were counterstained with Nuclear Fast Red Counterstain (Vector Laboratories, Burlingname, CA, USA).
Schultheiss C.S., Laggai S., Czepukojc B., Hussein U.K., List M., Barghash A., Tierling S., Hosseini K., Golob-Schwarzl N., Pokorny J., Hachenthal N., Schulz M., Helms V., Walter J., Zimmer V., Lammert F., Bohle R.M., Dandolo L., Haybaeck J., Kiemer A.K, & Kessler S.M. (2017). The long non-coding RNA H19 suppresses carcinogenesis and chemoresistance in hepatocellular carcinoma. Cell Stress, 1(1), 37-54.
+ Open protocol