The largest database of trusted experimental protocols

Minibest universal genomic dna extraction kit ver 5

Manufactured by Takara Bio
Sourced in Japan, China

The MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 is a laboratory equipment product designed for the extraction and purification of genomic DNA from a variety of sample types. It utilizes a silica-based membrane technology to effectively capture and isolate DNA, providing a reliable and efficient method for DNA extraction.

Automatically generated - may contain errors

29 protocols using minibest universal genomic dna extraction kit ver 5

1

Quantifying Engrafted hMSCs in Rat Hearts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human sex determination SRY gene copy number in female rat heart tissues following hMSCs transplantation was measured by real time PCR. In brief, the whole heart tissues from different groups were frozen and pulverized with liquid nitrogen. Genomic DNA was extracted using MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (Takara, Japan) according to the manufacturer's instructions. Real time PCR was performed with SYBR green reaction mix using 7500 fast real time PCR system (Applied Biosystems, Carlsbad, CA, USA) according to manufacturer's instructions. Primers used include: human SRY gene forward primer 5′ GGTAAGTGGCCTAGCTGGTG 3′, reverse primer 5′GATCCCGCTTCGGTACTCTG 3′ rat 36B4 gene: forward primer 5′-CTCACTCCATCATCAATGGATACAA-3′, reverse primer 5′-CAGCCAGTGGGAAGGTGTAGTCA-3′. The reaction conditions were 95 °C for 30 s followed by 40 cycles of 95°C for 5 s, 56°C for 31 s and 95°C for 15 s. Engrafted hMSCs numbers were evaluated using the comparative ΔΔCt comparative method.
+ Open protocol
+ Expand
2

Transgenic Mouse Generation via miR-31 Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
In accordance with previously described methods, oosperm were harvested from normal pregnant mice and micro-injected with the miR-31 overexpression vector. Oosperm containing the miR-31 overexpression vector were transferred into the oviduct of pseudopregnant mice to generate neonates with positive miR-31 overexpression. Four weeks after birth, approximately 1 cm of the tails of mouse pups was excised. Total DNA was extracted (TaKaRa MiniBEST Universal Genomic DNA Extraction Kit ver. 5.0 TaKaRa Bio, Japan) and amplified via PCR. The reaction system including 2 μL DNA, 1 μL primer, 25 μL premixTaq, 22 μL DEPC H2O.[10 ] Agarose gel electrophoresis was performed to identify vector-positive mice.
+ Open protocol
+ Expand
3

Methylation Analysis of ccRCC Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNAs from the 19 ccRCC tissues were extracted with TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0. DNA concentrations were measured with a NanoDrop2000 spectrophotometer (USA). The methylation levels of CpG sites were evaluated with pyrosequencing. PyroMark Assay Design software (Qiagen) was used to design specific sets of primers for CpG PCR amplification and sequencing. The cg08995609 forward primer: GAGGGTTTTAGTTGGGGGATGTTA, reverse primer: ACCTAAAACCAAAAACAAATAAACAACT, sequencing primer: GTTGGGGGATGTTAT. All manipulations of bisulfite conversions, PCRs and pyrosequencings were previously described33 (link). DNA methylation of RAB25 promoter was quantified by MassARRAY EpiTYPER assays (Sequenom, San Diego, CA, USA). Primers were designed using the software sequenom®EpiDesigner, RAB25 sequences of PCR primers used in the study, tag-forward: aggaagagagGTATTGTTGGGTTTTTGGAATTTGT; tag-reverse: cagtaatacgactcactatagggagaaggctATCTCAACCCCTAAAACCTCTACC. Procedures of methylation assessments and quality controls had been described previously49 (link).
+ Open protocol
+ Expand
4

Barley HvAACT1 Gene Insertion Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA was extracted from shoots according to the instructions of MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (TaKaRa, Japan). To examine the presence of the insertion in three barley genotypes, upstream fragments of the HvAACT1 encoding region were amplified by PCR using KOD-FX (Toyobo, Japan) from the genomic DNA. PCR primers (5’-GGTCCAACACTCTACCCTTCCTT-3’and5’-GGTGCGAGTTGCCCCTAGCTATTACAGA-3′) were used as showed by Fujii et al. [23 (link)]. The PCR products were separated by electrophoresis of 120 V running for 30 min on a 1% agarose gel using 1 × TAE buffer and stained with 4S green plus nucleic acid stain (Sangon Biotech, Shanghai, China).
+ Open protocol
+ Expand
5

Genomic DNA Extraction from Blood

Check if the same lab product or an alternative is used in the 5 most similar protocols
Blood samples were collected from the clinical laboratory of the Seventh Affiliated Hospital of Sun Yat-sen University under an approved Institutional Review Board protocol. Genomic DNAs were purified by using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (TaKaRa, Shiga, Japan). For each PCR reaction described below, around 1 μg total DNA was used.
+ Open protocol
+ Expand
6

DNA Extraction from C. umbratile Juveniles

Check if the same lab product or an alternative is used in the 5 most similar protocols

C. umbratile juveniles were collected from South China Sea (Longitude 5°20.267′ N and latitude 109°48.435′ E) in September 2014 and directly frozen. Muscle tissues were used for DNA extraction according to the Genomic DNA Extraction Kit’s instructions (TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0, Japan). The quantity (concentration) of isolated total DNA was determined by NANODROP 2000 spectrophotometer (Thermo Scientific, USA). Furthermore, quality of extracted DNA was assessed by electrophoresis on a 1% agarose gel stained with Gel Red™ (Biotium).
+ Open protocol
+ Expand
7

Circular RNA Extraction and Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Trizol (Invitrogen, Carlsbad, CA, USA) was adopted to extract total RNA from MVN, and the concentration and purity of the extracted RNA were detected by a nanodrop2000 micro ultraviolet spectrophotometer (1011U, nanodrop, USA). Next, 2 μg total RNA was added with 3 U/μg RNase R (Epicenter Technologies, Madison, WI, USA) and incubated at 37 °C for 30 min. RNeasy MinElute Cleaning kits (Qiagen GmbH, Hilden, Germany) were used for purification. The expression of circ_0000811 was detected after reverse transcription to obtain cDNA and observed by agarose gel electrophoresis. Genomic DNA (gDNA) of MVN was extracted with MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (Takara, Japan). Based on the designed convergent polymer primers and divergent primers, circ_0000811 was detected in cDNA and gDNA and observed by agarose gel electrophoresis.
+ Open protocol
+ Expand
8

Quantifying Viral DNA in Silkworms

Check if the same lab product or an alternative is used in the 5 most similar protocols
Purified Bm-SP142 was incubated with virus, which was subsequently used to infect silkworms, and the level of viral DNA in virus-infected silkworms was determined by qPCR. Briefly, 200 μl of BmBDV or BmNPV was incubated with 200 μl of purified Bm-SP142 for 24 h. Meanwhile, 200 μl of the same viral titre of BmBDV or BmNPV was incubated with 200 μl of blank eluted solution for 24 h as a control. Next, 5 μl of BmBDV was orally administered to 5th instar larvae or subcutaneously injected into 5th instar larvae. Silkworms were infected with the same virus treated with blank eluted solution (control group). A total of 30 silkworms were included in each group.
After cultivation for 48 h with fresh mulberry, silkworms were dissected to collect midgut samples, and total DNA was extracted using a MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (TaKaRa). Primer pair GP64-F and GP64-R were used to amplify the BmNPV GP64 gene from the extracted DNA by qPCR, and primer pair ns1F and ns1R were used to amplify ns1. The amplified DNA fragments were used to indicate the abundance of viral DNA in virus-infected insects.
+ Open protocol
+ Expand
9

Comprehensive RNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was isolated with MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (Takara, Japan), and total RNA was isolated by using RNAiso Plus (Takara, Janpan) according to the manufacturer’s instructions. For RNase R digestion, 2 μg of total RNA was incubated for 30 min at 37 °C with or without RNase R (3 U/μg) (Epicentre Technologies, USA), and the treated RNA was subsequently purified with the RNeasy MinElute Cleanup Kit (Qiagen, Germany). The nuclear and cytoplasmic fractions were extracted using a PARIS™ Kit (Life Technologies, USA) according to the manufacturer’s protocol. cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara, Japan), and RT-PCR was performed on a Quantstudio™ DX system (Applied Biosystems, Singapore) using TB Green Premix Ex Taq II (Takara, Japan). GAPDH and small nuclear U6 were used as internal controls. The sequence information of primers was listed in Additional file 1: Table S1.
+ Open protocol
+ Expand
10

NTCP S267F Genotyping by PCR-RFLP

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was isolated from whole blood using the MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (Takara) according to the manufacturer’s instruction. The S267F polymorphism of NTCP was determined using the polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) method as described19 (link).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!