No amperase ung

Manufactured by Thermo Fisher Scientific

Sourced in United States, Lithuania

No AmpErase UNG is a lab equipment product designed to prevent DNA contamination in PCR reactions. It functions by eliminating carry-over amplicons from previous PCR runs, thereby reducing the risk of false-positive results.

Automatically generated - may contain errors

Lab products found in correlation

99 protocols using no amperase ung

Quantitative Analysis of miRNA and mRNA Expression in BAL Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The gene expression for each miRNA and mRNA in BAL cells was investigated by qRT-PCR using specific primers and probes (see Table S1 and Table S2, in Supplementary Material available online at http://dx.doi.org/10.1155/2015/121378). qRT-PCR for each individual miRNA was performed in a 20 μL reaction mixture that included 1.3 μL of diluted RT product, 1 μL of 20X TaqMan Individual microRNA assay, 10 μL of 2X TaqMan Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems), and 7.7 μL of nuclease-free water. qRT-PCR for each individual mRNA expression was performed as described previously [21 (link)]. All reactions were performed on RotorGene3000 system (Qiagen Inc., Valencia, CA, USA); the reaction steps were as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. The relative miRNA and mRNA expression levels were calculated by a second-derivative method (RotorGene Software 6.1.81, Corbett, Sydney, Australia); cDNA from human universal reference RNA (Stratagene, La Jolla, CA, USA) was used as a calibrator. A reference gene for miRNA analysis was endogenous control Mammalian U6 and for mRNA a reference gene PSMB2 [21 (link)]. Changes in expression levels are presented as mean relative expression with 95% confidence interval (CI).

Dyskova T., Fillerova R., Novosad T., Kudelka M., Zurkova M., Gajdos P., Kolek V, & Kriegova E. (2015). Correlation Network Analysis Reveals Relationships between MicroRNAs, Transcription Factor T-bet, and Deregulated Cytokine/Chemokine-Receptor Network in Pulmonary Sarcoidosis. Mediators of Inflammation, 2015, 121378.

+ Open protocol

+ Expand

miRNA Isolation and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cellular total RNA was isolated with mirVana™ miRNA isolation kit according to the manufacturer’s instruction. The reverse transcription of miRNAs was performed with the Applied Biosystems^® TaqMan^® MicroRNA Reverse Transcription kit and Applied Biosystems^® 5x RT primer. The quantitative PCR amplifications of samples were done via Applied Biosystems^® TaqMan^® Universal PCR Master Mix, No AmpErase^® UNG and 20x TaqMan small RNA Assay with protocol provided.

Zhao Y., Li Y., Luo P., Gao Y., Yang J., Lao K.H., Wang G., Cockerill G., Hu Y., Xu Q., Li T, & Zeng L. (2016). XBP1 splicing triggers miR-150 transfer from smooth muscle cells to endothelial cells via extracellular vesicles. Scientific Reports, 6, 28627.

+ Open protocol

+ Expand

Quantifying Mitochondrial and Nuclear DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA was extracted and purified using the Puregene Core A Kit (QIAGEN) following the manufacturer’s instructions including RNAse treatment. The purity and quantity of DNA were evaluated with the NanoDrop 2000 (Thermo Fisher Scientific) and 5 ng/μl DNA were analysed by qPCR. qPCR was carried out using the Taqman 2× Universal PCR mastermix, No Amperase UNG (Applied Biosystems), and commercially available Taqman assay probes for mouse mitochondrial (COX1, Mm04225243_g1) and nuclear DNA (18S, Hs99999901_s1).

Bonekamp N.A., Jiang M., Motori E., Garcia Villegas R., Koolmeister C., Atanassov I., Mesaros A., Park C.B, & Larsson N.G. (2021). High levels of TFAM repress mammalian mitochondrial DNA transcription in vivo. Life Science Alliance, 4(11), e202101034.

+ Open protocol

+ Expand

Quantifying miRNA Levels via TaqMan Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

In the TaqMan microRNA Assay (Applied Biosystems, Foster City, CA, USA), hsa-miR-132 ID 000457 and RNU6B ID 001093 were used to measure miRNA levels. The TaqMan MicroRNA Reverse Transcription kit and TaqMan 2× universal PCR Master Mix, No AmpErase UNG (Applied Biosystems), were used according to the manufacturer’s protocol. The 7900HT Sequence Detection System 2.3 (Applied Biosystems) software was used to compute the relative change in RNA expression by the

2^{- Δ Δ C_{t}}

method.

Mokutani Y., Uemura M., Munakata K., Okuzaki D., Haraguchi N., Takahashi H., Nishimura J., Hata T., Murata K., Takemasa I., Mizushima T., Doki Y., Mori M, & Yamamoto H. (2016). Down-Regulation of microRNA-132 is Associated with Poor Prognosis of Colorectal Cancer. Annals of Surgical Oncology, 23(Suppl 5), 599-608.

+ Open protocol

+ Expand

Profiling miRNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from cultured cell lines was isolated using Trizol; total RNA from flow-sorted cells was isolated using the RNAqueous-Micro kit (Ambion, Austin, TX, USA) following manufacturer instructions. 10,000-50,000 cells were collected in provided lysis buffer. Analysis of mature miR-141, miR-200abc, and RNU6B (used for normalization) used TaqMan MicroRNA Assays, TaqMan MicroRNA RT kit, and TaqMan Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems, Carlsbad, CA, USA). Primers for pri-miR-141 and pri-200c were designed to flank their respective stem-loop, and analysis was performed using the Verso cDNA Synthesis kit and ABsolute Blue Sybr Green with Fluorescein (Thermo-Fisher Scientific). β-actin was used for normalization. The relative mRNA or miRNA levels were calculated using the Pfaffl method (61 (link)).

Finlay-Schultz J., Cittelly D.M., Hendricks P., Patel P., Kabos P., Jacobsen B.M., Richer J.K, & Sartorius C.A. (2014). Progesterone downregulation of miR-141 contributes to expansion of stem-like breast cancer cells through maintenance of progesterone receptor and Stat5a. Oncogene, 34(28), 3676-3687.

+ Open protocol

+ Expand

Quantification of piRNA, mRNA, and snRNA levels

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Taqman cDNA synthesis was performed as previously described (Weiser et al., 2017 (link)). Briefly, for quantification of piRNA levels, TaqMan small RNA probes were designed and synthesized by Applied Biosystems. All piRNA species assessed by qPCR were normalized to U18 small nucleolar RNA. Fifty nanograms of total RNA was used for cDNA synthesis. cDNA was synthesized by Multiscribe Reverse Transcriptase (Applied Biosystems) using the Eppendorf Mastercycler Pro S6325 (Eppendorf). Detection of small RNAs was performed using the TaqMan Universal PCR Master Mix and No AmpErase UNG (Applied Biosystems). For quantification of mRNA levels, cDNA was made using 500 ng of total RNA using Multiscribe Reverse Transcriptase (Applied Biosystems). For quantification of snRNA levels, cDNA was made using 250 ng of total RNA using SuperScript III Reverse Transcriptase (ThermoFisher). Assays for mRNA and snRNA levels were performed with Absolute Blue SYBR Green (ThermoFisher) and normalized to eft-2 using CFX63 Real Time System Thermocyclers (Bio-Rad). All qPCR primers used are listed in Supplementary file 4.

Choi C.P., Tay R.J., Starostik M.R., Feng S., Moresco J.J., Montgomery B.E., Xu E., Hammonds M.A., Schatz M.C., Montgomery T.A., Yates JR I.I.I., Jacobsen S.E, & Kim J.K. (2021). SNPC-1.3 is a sex-specific transcription factor that drives male piRNA expression in C. elegans. eLife, 10, e60681.

+ Open protocol

+ Expand

Quantitative PCR for SNP Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative PCR was performed using the LightCycler 480 II (Roche), according to manufacturer’s instructions, using a mixture containing 45 ng cDNA, 1xTaqMan Universal PCR Master Mix, no AmpErase UNG (Applied Biosystems), 1xTaqMan SNP Genotyping Assay (Applied Biosystems), and nuclease-free water (Ambion) in a 20 μl reaction volume. ACTB (Applied Biosystems, cat#Hs99999903_m1) was included as reference gene. A standard curve was generated using pooled equal amounts of cDNA from all samples. Quantification of the dual-color hydrolysis of both allele-specific fluorescent reporter dyes, FAM (“G” allele) and VIC (“A” allele), was performed with the LightCycler 480 SW 1.5.1 software (Roche) using the 2^nd derivative method, according to manufacturer’s instructions.

Evers M.M., Schut M.H., Pepers B.A., Atalar M., van Belzen M.J., Faull R.L., Roos R.A, & van Roon-Mom W.M. (2015). Making (anti-) sense out of huntingtin levels in Huntington disease. Molecular Neurodegeneration, 10, 21.

+ Open protocol

+ Expand

Quantitative PCR for T-Antigen Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted as above. After brief centrifugation, 2 μl of the supernatant was transferred to 10 μl PCR reactions. PCR reactions were prepared using TaqMan Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems). PRP-3 plasmid (containing the T-antigen sequence) [16 (link)] was serial diluted in FVB tail lysate to generate a standard curve. Primers for amplification of an 18 bp amplicon internal to the T-Antigen sequence were 5′-GCTAATGGACCTTCTAGGTCTTGAA-3′ and 5′-AAATATGCCTTTCTCATCAGAGGAATA-3′ and the probe was 5′ FAM- CCCCAGGCACTCC-TAMRA-3′. Samples were normalized to Albumin. Primers used were Alb-forward: 5’-TTCCTGCAACACAAAGATGACA-3’ and reverse: 5’-CAGCCTCTG GCCTTTCAAAT-3’ Alb-probe: probe CCCCAGCCTGCCAC. Reactions were run in 384-well format in an ABI Prism 7900HT with the following conditions: 95°C for 1 min, followed by 95°C for 15 s, 60°C for 1 min repeated for 40 cycles.

Aprelikova O., Tomlinson C.C., Hoenerhoff M., Hixon J.A., Durum S.K., Qiu T.H., He S., Burkett S., Liu Z.Y., Swanson S.M, & Green J.E. (2016). Development and Preclinical Application of an Immunocompetent Transplant Model of Basal Breast Cancer with Lung, Liver and Brain Metastases. PLoS ONE, 11(5), e0155262.

+ Open protocol

+ Expand

Quantification of miRNA Expression Using qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was transcribed from 10 ng of total RNA using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA) in a total volume of 15 μl according to the manufacturer’s protocol. The relative expression of miRNAs was assessed by qPCR reactions using TaqMan probes for the studied miRNA (Applied Bio-systems, Carlsbad, CA) according to the manufacturer’s protocol. The following microRNA probes were used for the study:
miR-124 (CGUGUUCACAGCGGACCUUGAU),
hsa-miR-210 (CUGUGCGUGUGACAGCGGCUGA),
hsa-miR-375 (UUUGUUCGUUCGGCUCGCGUGA).
The PCR mixture contained: 1.0 μl of TaqMan MicroRNA Assay (20X) 1.33 μl of product from RT reaction, 10.00 μl of TaqMan 2X Universal PCR Master Mix, No AmpErase UNG, and 7.76 μl of nuclease-free water (Applied Biosystems, Carlsbad, CA). The plates were placed in the Applied Biosystems 7900HT Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA) according to the manufacturer’s protocol. The expression levels (RQ values) of the studied miRNA were calculated using the delta delta CT method.

Khalid K., Szewczyk A., Kiszałkiewicz J., Migdalska-Sęk M., Domańska-Senderowska D., Brzeziański M., Lulińska E., Jegier A, & Brzeziańska-Lasota E. (2020). Type of training has a significant influence on the GH/IGF-1 axis but not on regulating miRNAs. Biology of Sport, 37(3), 217-228.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Inflammatory Mediators

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using RNeasy mini extraction kit (Qiagen, Valencia, CA, USA) for cultured peritoneal macrophages or Tri reagent (MRC, OH, USA) for brain tissues. Total RNA was reverse-transcribed using oligo (dT) primers and the SuperScript First-Strand Synthesis System (Invitrogen) according to the manufacturer’s protocol. PCR primers and probes specific for MCP-1, IL-6, CCR2, CD36, and β-actin (an internal control) were obtained as TaqMan pre-developed optimized assay reagents for gene expression (Applied Biosystems, Foster City, CA, USA). The PCR reaction was performed using TaqMan Universal PCR Mastermix, No AmpErase UNG, and 7500 Fast Real-Time PCR system (Applied Biosystems) according to the manufacturer’s protocol. Reactions were performed in 20 μL total volume and incubated at 95°C for 10 min, followed by 40 cycles of 15 sec at 95°C, and 1 min at 60°C. The results were analyzed by 7500 Fast Real-Time PCR system software (Applied Biosystems).

Kim E., Tolhurst A.T, & Cho S. (2014). Deregulation of inflammatory response in the diabetic condition is associated with increased ischemic brain injury. Journal of Neuroinflammation, 11, 83.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!