Miseq amplicon sequencing

The genomic deoxyribonucleic acid (DNA) of the rhizosphere soil samples was extracted using the MN NucleoSpin 96 SOI kit (Omega Bio-tek, Norcross, GA, USA), and then the purity and concentration of the DNA were evaluated by 1% agarose gel electrophoresis. The diluted genomic DNA was sequenced by Illumina MiSeq amplicon sequencing using primers labeled with Barcodes: ITS1 F, 5′-CTTGGTCATTTAGAGGAAGTAA-3′ (Gardes and Bruns, 1993 (link)); ITS2 R, 5′-GCTGCGTTCTTCATCGATGC-3′ (White et al., 1990 (link)), to the fungal ITS1–ITS2 regions. Using a 96-well PCR machine (AB), the obtained PCR products were purified by 2% agarose gel electrophoresis by using the Monarch DNA gel extraction kit (New England Biolabs, MA, USA). The library was constructed using the TruSeq DNA PCR-Free Library Preparation Kit from Illumina Company, and then Qubit was used for quantification and library detection. After passing the test, NovaSeq 6000 was used for on-machine sequencing. High-throughput sequencing was performed by Beijing Guoke Biotechnology Co., LTD, Beijing, China.

For Illumina MiSeq Amplicon sequencing, 95 buffy coat, 48 cecum and 14 extraction control samples were processed. The variable region V3/V4 of the 16S rRNA gene was targeted using the published gene-specific sequences (Klindworth et al., 2013 (link)). Illumina adapter overhang nucleotide sequences were added to gene-specific sequences. The resulting full-length primer sequences used were 16S forward primer 5′TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTAC GGGNGGCWGCAG, reverse primer 5′ GTCTCGTGGGCT CGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTA ATCC. Library preparation including sample quantity control, NextEra two-step PCR amplification, equimolar pooling of samples and sequencing with a 250 bp paired-end read protocol (V3-V4) using an Illumina MiSeq sequencing platform were performed by the Next Generation Sequencing facility of the Vienna BioCenter Core Facilities,¹ Austria.

PCR amplification, Illumina MiSeq amplicon sequencing, and data processing were performed as stated elsewhere (Zeibich et al., 2019 (link); Meier et al., 2021 (link)). In short, primers Pro341f (5′-CCT ACG GGN BGC ASC AG-3′) and Pro805r (5′-GAC TAC NVG GGT ATC TAA TCC-3′; Takahashi et al., 2014 (link)) were used for 16S rRNA amplicon generation, quality filtered sequences were clustered using a 97% similarity cut-off, and chloroplast- and mitochondria-related sequences were excluded from further analyses.

Samples of vinegar pei and the precipitates was prepared on the basis of the previous method and the DNA of the sample was extracted (Wu et al., 2017 (link); Huang et al., 2022 (link)). The qualified DNA was submitted to Majorbio Biopharm Technology Co., Ltd (Shanghai, China) for Illumina MiSeq amplicon sequencing (2 × 300 bp). Primers 338F and 860R were used to amplify the V3-V4 region of bacterial 16S rRNA gene. For fungi, the internal transcribed spacer (ITS) region was amplified with primers ITS1F and ITS2 (Nie et al., 2013 (link); Huang et al., 2022 (link)). After sequencing, the raw sequences were quality-filtered by removing sequences as previously described (Zhang et al., 2020 (link)). Qualified reads from all samples were removed chimera sequences and assigned to operational taxonomic units (OTUs) at a 97% sequence similarity threshold with QIIME (version 1.9.1) pipeline (Caporaso et al., 2010 (link)). The representative OTU sequences were aligned against the bacterial 16S rRNA gene database Greengenes (version 13.8) (DeSantis et al., 2006 (link)) and the fungal ITS database UNITE (version 7.1) (Abarenkov et al., 2010 (link)) for taxonomic classification. The analysis of alpha-diversity and betadiversity were conducted after rarefying all samples to the same sequencing depth (Huang et al., 2022 (link)).

For Illumina MiSeq Amplicon sequencing, samples from the four runs were pooled according to treatment, resulting in 50 samples: 24 solid phase samples (eight treatments for CP I, SARA, and CP II, respectively), 24 liquid phase samples (eight treatments for CP I, SARA, and CP II, respectively), and two native samples (solid and liquid). Additionally, three negative control samples (solid, liquid, and native) from the DNA extraction were processed together with the samples to identify contaminating bacterial reads. Illumina MiSeq sequencing of pooled samples was applied to increase comparability with already published in vivo data, which is, most of the time, based on Illumina sequencing and to gain a general overview of the microbial community composition. The hypervariable region 4 was targeted using the primer set 515F and 806R (Caporaso et al., 2011 (link)). Library preparation, including sample quality control, Nextera two-step PCR amplification, equimolar pooling of samples, and sequencing with a 250 bp paired-end reads protocol (V3) using an Illumina MiSeq sequencing platform (one lane) were performed by the Next Generation Sequencing facility of the Vienna Biocenter Core Facilities⁴.