Pgl3 basic luciferase expression vector

PCR amplification was performed using PrimeSTAR GLX DNA polymerase (Takara, Japan) on human genomic DNA, priming a region of 473bp from 40 512 263 to 40 512 735 of chromosome 2 (GRCh38/hg38). The primers used for the amplification included XhoI and EcoRI restriction sites, absent in the target gene. The endonucleases sites were incorporated in the forward and reverse primers when a target region was generated by PCR (Fw primer: 5′‐ATAGAGAGTAGAAATGCCAATCTC‐3′; Rv primer: 5′‐GGCCCTTAAAGGACATCAAGGG‐3′; endonucleases binding sites are underlined). The PCR product was purified using StrataPrep DNA gel extraction kits (Agilent, Milan, Italy) and cloned into multiple cloning sites of pGL3‐basic luciferase expression vector (Promega, Milan, Italy). The fidelity of the constructs was confirmed by DNA sequencing. Site‐directed mutations were carried out in the REST binding sequence using the quick change site‐directed mutagenesis kit (Agilent) using the forward primer: 5′‐CTGTTGGGAACAGATCCATGGAAGCGAAAGCCGAAAG‐3′ and the reverse primer 5′‐CTTTCGGCTTTCGCTTCCATGGATCTGTTCCCAACAG‐3′ (mutated bases are underlined), according to the manufacturer's instructions, as previously reported.
³ (link) Finally, mutations were confirmed by DNA sequencing.

The 404-bp fragment, containing the CDK4 promoter subcloned into pGL3-basic luciferase expression vector (Promega, Madison, WI, USA), was a kind gift of Dr Gary L Firestone (Department of Molecular and Cell Biology, University of California at Berkeley, Berkeley, CA, USA). All transfections were carried out in 24-well plates. Briefly, plasmids (1 μg CDK4 promoter construct, 0.1 μg Renilla luciferase expressing reporter vector pRL-Null [Promega]), were introduced into <50% confluent K562 cells with Lipofectamine® LTX transfection reagent (Life Technologies, Grand Island, NY, USA). The CDK4 and control empty vectors were transfected into K562 cells at a density of 0.2×10⁶ viable cells/mL per well in a 24-well plate. Twenty-four hours after transfection, cells were treated with 2.5 μM PNT2258 for 48 hours. Cells were lysed 48 hours later, and promoter activity analyzed in a MicroLumat Plus LB96V reader (Berthold Technologies, Bad Wildbad, Germany) using the Dual Luciferase® Reporter Assay System (Promega). The firefly luciferase values were normalized to those of Renilla luciferase; all transfections were repeated at least three times.