Kapa sybr fast universal qpcr kit

Manufactured by Merck Group

Sourced in Sweden, United States

The KAPA SYBR FAST Universal qPCR kit is a reagent kit designed for real-time quantitative PCR (qPCR) analysis. The kit contains all the necessary components for performing fast and accurate qPCR reactions, including a highly-processive and robust DNA polymerase, SYBR Green I dye for DNA detection, and optimized buffer system.

Automatically generated - may contain errors

Lab products found in correlation

Rotor gene q machine, by Roche (2 mentions) Rotor gene q, by Qiagen (2 mentions) Quantitect rt kit, by Qiagen (2 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Mirneasy mini kit, by Qiagen (1 mentions) Rotor gene 6000, by Qiagen (1 mentions) On column dnase digestion kit, by Qiagen (1 mentions) Rneasy micro kit, by Qiagen (1 mentions) Nextseq 500 platform, by Illumina (1 mentions) Smart seq ultra low input rna kit, by Takara Bio (1 mentions) Bioanalyzer, by Agilent Technologies (1 mentions) Rneasy mini kit, by Qiagen (1 mentions)

Spelling variants of this product

KAPA SYBR FAST (36 citations) KAPA SYBR FAST Universal (3 citations)

7 protocols using kapa sybr fast universal qpcr kit

qRT-PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the QIAGEN miRNeasy Mini Kit (Germantown, MD, USA, Cat: 217004) and cDNA synthesis was conducted using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, San Francisco, CA, USA, Cat: 4374966), following the manufacturer’s protocols. A quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed as per the manufacturer’s instructions using the Kapa Sybr Fast Universal qPCR Kit (Sigma-Aldrich, Cat: KK4600) and results were generated with the MxPro QPCR 4.10 software. The primers (Sigma-Aldrich) used in the experiments were as follows:

(1)

Rpl19 (housekeeping gene)

fp CCGACGAAAGGGTATGCTCA
rp GGGCAACAGACAAAGGCTTG
fp GTACCCGCATCTGCACAAC
rp CTCCTCCACGAAGGGTCTCT
fp GTTCCCTGGGGAGCTTCT
rp TTACTATCTAGGGCCGCCATT
fp CTCGGTTTGCTGATGGGGACG
rp GCTTGAATCCTCCAAAAGGTGCGG
fp GAAGTGAAAGAGCGGGTGAG
rp CTGTTGACCAGCGCAAAG
fp CAAGGGAGCATCAAACAACA
rp GTCCTCTGTGCCATCCTCAT
fp ACCCTCCGCTTCCAGAAC
rp GAGGCCTTCTCCGAGTCAC
fp GCTGCTCGCTTTCTCTGC
rp GCTGTAATCCACATCGCTCTC

Kakogiannis D., Kourla M., Dimitrakopoulos D, & Kazanis I. (2024). Reversal of Postnatal Brain Astrocytes and Ependymal Cells towards a Progenitor Phenotype in Culture. Cells, 13(8), 668.

+ Open protocol

+ Expand

Quantifying Streptococcus mutans in Saliva

Check if the same lab product or an alternative is used in the 5 most similar protocols

S. mutans in whole saliva was quantified by culturing and qPCR (Yano et al., 2002 ). Serial dilutions of whole saliva were cultured on MSB agar plates and counted for colony-forming units of S. mutans (designated as ms). Plaque DNA purified from whole saliva samples was measured by qPCR using the KAPA SYBR FAST Universal qPCR kit (Sigma-Aldrich, Sweden) and Corbett Rotor-Gene 6000 and S. mutans specific primers (Table S2). Quantitative calibration curves from DNA prepared from serial dilutions of S. mutans strain Ingbritt (Esberg et al., 2012 (link)) were used to transform the qPCR responses into colony-forming units.

Esberg A., Sheng N., Mårell L., Claesson R., Persson K., Borén T, & Strömberg N. (2017). Streptococcus Mutans Adhesin Biotypes that Match and Predict Individual Caries Development. EBioMedicine, 24, 205-215.

+ Open protocol

+ Expand

Quantitative PCR Analysis of IP Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR reactions were run as technical duplicates on a Rotor Gene Q machine (Roche) using the KAPA SYBR Fast universal qPCR kit (Sigma) in 10-µl reactions with 1 µl eluted DNA for the IP material or 1 µl of a 1:10 dilution of the input material. Delta Ct values were calculated over input, followed by delta Ct and fold change over an intergenic region. Primers are listed in Supplementary Table 1. Corresponding plots were generated with Prism (5.0a).

Butz S., Schmolka N., Karemaker I.D., Villaseñor R., Schwarz I., Domcke S., Uijttewaal E.C., Jude J., Lienert F., Krebs A.R., de Wagenaar N.P., Bao X., Zuber J., Elling U., Schübeler D, & Baubec T. (2022). DNA sequence and chromatin modifiers cooperate to confer epigenetic bistability at imprinting control regions. Nature Genetics, 54(11), 1702-1710.

+ Open protocol

+ Expand

Transcriptome Profiling of Human Adipose Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted and purified from human fat specimens using a Qiagen RNeasy Micro kit (Qiagen), and residual genomic DNA was further removed by an on-column DNase digestion kit (Qiagen). Library construction, sequencing, and data analysis were performed at the Center for Cancer Computational Biology Core Facilities at Dana-Farber Cancer Institute (DFCI). Sequencing libraries were prepared using a SMART-Seq Ultra Low Input RNA kit (Clontech). The resulting library size distributions were analyzed using a Bioanalyzer (Agilent). The concentration of the library was determined using a DNA High-Sensitivity Qubit assay, and the final functional library concentration was determined through qPCR using Illumina adaptor-specific primers with a KAPA SYBR FAST Universal qPCR kit (Sigma–Aldrich).The library pools were loaded at final concentrations of 2 pM on single-read 75 flow cells and sequenced on an Illumina NextSeq 500 platform. Sequencing reads were aligned to the reference genome (Ensembl GRCh37.75) using the RNA-specific STAR aligner (v2.3.1z4).

Fazeli P.K., Zhang Y., O'Keefe J., Pesaresi T., Lun M., Lawney B, & Steinhauser M.L. (2020). Prolonged fasting drives a program of metabolic inflammation in human adipose tissue. Molecular Metabolism, 42, 101082.

+ Open protocol

+ Expand

Quantitative PCR for Chromatin IP

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR reactions were run as technical duplicates on a Rotor Gene Q machine (Roche) using the KAPA SYBR Fast universal qPCR kit (Sigma) in 10-μl reactions with 1 μl eluted DNA for the IP material or 1 μl of a 1:10 dilution of the input material. Delta Ct values were calculated over input, followed by delta Ct and fold change over an intergenic region. Primers are listed in Supplementary Table 1. Corresponding plots were generated with Prism (5.0a).

+ Open protocol

+ Expand

Quantitative PCR of RNA Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA were purified as above, 1 μg RNA was subjected to reverse transcription by Quantitect RT kit (Qiagen). Quantitative PCR was performed using the KAPA SYBR Fast (Universal) qPCR kit (Merck Millipore) according to the manufacturer’s recommendations. The qRTPCR reaction was performed with a Rotor-GeneQ (Qiagen) and the same thermal profile conditions were set as 95°C for 10 min; then 40 cycles were performed of 10 s at 95°C, 20 s 60°C and 20 s 7°C. The following primer pairs were used: TNIP1 forward 5′-CTAGTGTGACGGCAGGTAAGG-3′, TNIP1 reverse 5′-GCTGCTTCATGGACCGGAA-3′; Actin forward 5′-GGACTTCGAGCAAGAGATGG-3′, Actin reverse 5′-AGCACTGTGTTGGCGTACAG-3′; HPRT1 forward 5′-TGACACTGGCAAAACAATGCA-3′, HPRT1 reverse 5′-GGTCCTTTTCACCAGCAAGCT-3′; 18s rRNA forward 5′-CGGCGACGACCCATTCGAAC-3′, 18s rRNA reverse 5′-GAATCGAACCCTGATTCCCCGTC-3′.

Zhou J., Rasmussen N.L., Olsvik H.L., Akimov V., Hu Z., Evjen G., Kaeser-Pebernard S., Sankar D.S., Roubaty C., Verlhac P., van de Beek N., Reggiori F., Abudu Y.P., Blagoev B., Lamark T., Johansen T, & Dengjel J. (2022). TBK1 posphorylation activates LIR-dependent degradation of the inflammation repressor TNIP1. The Journal of Cell Biology, 222(2), e202108144.

+ Open protocol

+ Expand

Quantitative Analysis of P62 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

NHF were treated with vehicle, 1 μM of TOP-N53, 100 μM of Sildenafil, and/or 40 mg/L of uric acid for 24 h and supplemented with 2.5 nM of ConA (2 h) when indicated. RNA was isolated with RNeasy Mini kit (Qiagen, Hilden, Germany) following the manufacturer’s guidelines. Reverse transcription was performed with Quantitect RT kit (Qiagen, Hilden, Germany), using 400 ng RNA as starting material. Quantitative PCR was then performed using the KAPA SYBR Fast (Universal) qPCR kit (Merck Millipore, Burlington, MA, USA) according to the manufacturer’s recommendations. The qRT PCR reaction was performed with a Rotor-GeneQ (Qiagen, Hilden, Germany) and the same thermal profile conditions were used for all primer sets: 95 °C for 10 min; then 40 cycles were performed of 10 s at 95 °C, 20 s 60 °C, and 20 s 72 °C. The following primer pairs were used: HPRT1 forward 5′-TGA CAC TGG CAA AAC AAT GCA-3′; HPRT1 reverse 5′-GGT CCT TTT CAC CAG CAA GCT-3′; P62 forward 5′-CAT CGG AGG ATC CGA GTG TG-3′; and P62 reverse 5′-TTC TTT TCC CTC CGT GCT CC-3′.

Martínez-Martínez E., Atzei P., Vionnet C., Roubaty C., Kaeser-Pebernard S., Naef R, & Dengjel J. (2022). A Dual-Acting Nitric Oxide Donor and Phosphodiesterase 5 Inhibitor Activates Autophagy in Primary Skin Fibroblasts. International Journal of Molecular Sciences, 23(12), 6860.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!