Quantitative real time pcr kit

Total RNA isolation was carried out using the RNA Purification Kit (Yi Shan Biotechnology Company, Shanghai, China). The complementary DNA (cDNA) was synthesized and amplified with the reverse transcription kit (Takara, Osaka, Japan). A quantitative real-time PCR kit (Takara, Osaka, Japan) was used to prepare cDNA from various cell samples, along with GAPDH as an internal control, and specific primers were used for amplification (NRF2: forward 5′-TCTGCCAACTACTCCCAGGT-3′ and reverse 5′- AATGTCTGCGCCAAAAGCTG -3′; P62: forward 5′-CCCTCTCCCAGATGCTGTCCAT-3′ and reverse 5′-G CCGCTCCGAT GTCATAGTTCT-3′; Keap1: forward 5′-CGTGGCTGTCCTCAATCGTCTC-3′ and reverse 5′-CGCTTCGGATGGTGTTCATTGC-3′; GAPDH: forward 5′-CAAATTCCATGGCACCGTCA-3′ and reverse 5′-AGCATCGCCCCACTTGATTT-3′).

Resveratrol (purity > 99%) was obtained from Nanjing Spring & Autumn Biological Engineering Co., Ltd. (Nanjing, China). PI3Kp85, phospho-PI3Kp85 (Tyr458), Akt, phospho-Akt (Ser473), phospho-PKD1 (Ser916), c-Myc, and Cav-1 antibodies were purchased from Cell Signaling Technology Inc. (Beverly, MA, USA). PKD1 was from Novus (Novus Biologicals, Littleton, Colorado). Klf5 antibody was obtained from Abcam (Cambridge, MA, USA). The phosphoserine antibody was purchased by Santa Cruz Biotechnology Inc. (Santa Cruz, USA). GAPDH antibodies were purchased from proteintech (Wuhan, China). Trizol was from Invitrogen Inc. (Carlsbad, CA, USA). Reverse transcription reaction Kit was from Toyobo Co.Ltd. (Osaka, Japan) and quantitative Real-time PCR kit was purchased from TAKARA Bio Inc. (Otsu, Shiga, Japan). All other chemicals were of the highest grade commercially available.

Upon reaching an 80 percent density within 6-well plates post lentivirus infection over 6 days, SW982 cells were harvested and thrice rinsed with PBS. Subsequent extraction of total RNAs was performed employing TRIzol reagent (Invitrogen, US), following the manufacturer’s instructions. The reverse transcription process was aided by the Prime ScriptTM RT reagent kit (Takara, China) to procure a single cDNA strand. mRNA quantification was then achieved via a Quantitative Real-Time PCR kit utilizing SYBR master mixture (DRR041B, Takara, China). The PCR reaction mixture (20 μl) included: 10 l SYBR PremixEx Taq (2), 0.8 μl Forward primers (10 μM), 0.8 μl Reverse primers (10 μM), 2 μl cDNA, 0.4 μl ROX Reference Dye (50×), as well as 6.0 μl ddH₂O. The following procedure parameters were established: 95 °C for five seconds, then 60 °C for thirty seconds (for a total of 40 cycles), followed by a holding period at 4 °C. The 2−ΔΔCT approach determined the fold changes in mRNA expression, with experimental outcomes being assessed in relation to GAPDH normalization. The sequences of the primers are shown in Appendix 1.