Bulge loop mirna qpcr primer set

The Trizol Reagent (TaKaRa) was used to extract and purify total RNA from tissues or cells. By using the One Drop OD‐1000+ Spectrophotometer (One drop Technologies), the quality and quantity of total RNA were confirmed. For lncRNA and mRNA analysis, cDNA was synthesized by the PrimeScript™ RT reagent kit (Takara) and was subjected to quantitative PCR with Applied Biosystems™ SYBR Reagent (Thermo Fisher Scientific). The miRNA expression levels were determined using the Bulge‐Loop miRNA qPCR Primer Set (RiboBio). All reactions were performed on the ViiA7 real‐time PCR System‐Life Tech (Applied Biosystems). The initial denaturation steps were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The relative expression levels were calculated via the 2^−ΔCt method. Relative expression levels of lncRNA and mRNAs were normalized to the endogenous control glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) and relative expression levels of miRNAs were normalized to the endogenous control U6. Three replicates were amplified each time to verify the results. The primer sequences for LINC00534 were as follows: forward: 5′‐TCTCACCTCAGCCTCGCAAG‐3′; reverse: 5′‐AGTTCAAGACCAGCCTGTTCAAG‐3′. Primer‐blast was used to test the specificity of the primers for LINC00534.

Total RNA was extracted from the serum of patients using the RNeasy Mini kit (Qiagen GmbH), according to the manufacturer's instructions. The Bulge-Loop™ miRNA qPCR primer set for hsa-miR-23b-3p (MQPS0000872-1-100) and U6 small nuclear RNA (snRNA, MQPS0000002-1-100) were purchased from Guangzhou RiboBio Co. Ltd. A total of 0.5 µg total RNA was used to synthesize cDNA in a 20 µl reaction volume at 42°C for 45 min using a PrimeScriptsis kit (cat. no. RR047A; Takara Bio, Inc.). RT-qPCR was performed in a 20 µl reaction volume using iQ™ SYBR Green Supermix (cat. no. 1708882AP; Bio-Rad Laboratories, Inc.) The thermocycling conditions were as follows: 95°C for 3 min, followed by 40 cycles of 95°C for 20 sec, 60°C for 30 sec and 70°C for 30 sec.
The 5S ribosomal RNA was used as the internal control for the serum miR-23b-3p level, which was quantified using the 2^−ΔΔCt method (24 (link)). All RT-qPCR experiments were performed in triplicate.

Total RNA was extracted using the RNAiso Reagent (TaKaRa) according to the manufacturer's instructions. The synthesis of cDNA was performed using the PrimeScript RT reagent kit (TaKaRa). qRT-PCR analysis was performed using the SYBR Green qPCR Master Mix (Bio-Rad). MiRNA levels were measured using the Bulge-Loop™ miRNA qPCR Primer Set (RiboBio) according to the manufacturer's instructions.

Total RNA was isolated from muscle or cells using RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol. The Bulge-Loop miRNA qPCR Primer Set (RiboBio) was used to determine the expression levels of miRNAs by quantitative real-time PCR with Takara SYBR Premix Ex Taq (TliRNaseH Plus) in a Roche Real-Time PCR Detection System. 5S was used as an internal control. For mRNA analysis, cDNA was synthesized using Takara PrimeScript 1st Strand cDNA Synthesis Kit and was subjected to qPCR with Takara SYBR Premix Ex Taq. To correct for potential variances between samples regarding differences in mRNA extraction and reverse transcription efficiency, gene expression was normalized to the expression of the reference gene 18S. The primer sequences were as we previously described.¹⁸ (link)