Lipofectin 2000

Manufactured by Thermo Fisher Scientific

Sourced in United States

Lipofectin 2000 is a transfection reagent used for the introduction of nucleic acids into eukaryotic cells. It facilitates the delivery of DNA, RNA, and other macromolecules into the cells.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Lipofectin (115 citations)

15 protocols using lipofectin 2000

Optimizing Caco-2 Cell Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transfection plasmids were purified using HiSpeed Plasmid Maxi Kit (QIAGEN, Valencia, CA). siRNAs were obtained from Invitrogen. Caco-2 cells were seeded in 6-well plates with 60–80% confluence. Transfections were carried out using the either Effectene Transfection Reagent (QIAGEN Valencia, CA) or Lipofectin 2000 (Invitrogen). Transfection efficiency and stability in Caco-2 cells was evaluated using a plasmid which expresses green fluorescent protein (GFP) gifted by Dr. Gary Clawson (Department of Pathology, Penn State College of Medicine, Hershey, PA). The conditions of transfection in all promoter vectors and siRNAs were optimized (plasmid or siRNAs concentrations, transfection reagent concentration over time, etc.) in the beginning of experiments. Cells were transfected with NF-κB expression vector or co-transfected with iκB-α wild-type into the cells when appropriate using Effectene Transfection Reagent. Empty vector (pCMV4) was utilized to be a control in all experiments. Similarly, CAT1 siRNAs or negative control were transfected with Lipofectin 2000 as directed by the manufacturer’s protocol. Transfections were allowed to proceed for 20–24 h before the reagent mixture was removed. Then cells were washed with PBS before adding fresh medium.

Meng Q., Cooney M., Yepuri N, & Cooney R.N. (2017). L-arginine attenuates Interleukin-1β (IL-1β) induced Nuclear Factor Kappa-Beta (NF-κB) activation in Caco-2 cells. PLoS ONE, 12(3), e0174441.

+ Open protocol

+ Expand

Transient Transfection of Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

BHK21 and Cos-7 cells were transiently transfected with Lipofectin 2000 (Invitrogen) according to manufacturer's instructions. 3134 and 3617 cells were transfected with jetPRIME reagent (VWR) according to manufacturer's instructions.

Presman D.M., Ogara M.F., Stortz M., Alvarez L.D., Pooley J.R., Schiltz R.L., Grøntved L., Johnson T.A., Mittelstadt P.R., Ashwell J.D., Ganesan S., Burton G., Levi V., Hager G.L, & Pecci A. (2014). Live Cell Imaging Unveils Multiple Domain Requirements for In Vivo Dimerization of the Glucocorticoid Receptor. PLoS Biology, 12(3), e1001813.

+ Open protocol

+ Expand

Pael-R Gene Silencing in Parkinson's Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pRNA-U6/Pael-R interference vector was designed for rat Pael-R gene and constructed as previously described[41 ]. Parkinson's disease model cells treated with rotenone were plated in 6-well plates at a density of 5 × 10⁵ cells/well for 24 hours. Then, the pRNA-U6/Pael-R vector was transfected into cells together with Lipofectin 2000 (Invitrogen) according to the manufacturer's protocol. Specifically, 4 μg of vector was mixed with 10 μL of Lipofectin 2000 reagent, and cells were incubated with the mixture for 24 hours. Cells can be collected for tests 48 hours after transfection.

Zou T., Tang X., Huang Z., Xu N, & Hu Z. (2014). The Pael-R gene does not mediate the changes in rotenone-induced Parkinson's disease model cells. Neural Regeneration Research, 9(4), 402-406.

+ Open protocol

+ Expand

Plasmid and siRNA Transfection Methods

Check if the same lab product or an alternative is used in the 5 most similar protocols

For transfection of plasmids, X-treme GENE9 DNA transfection reagent (Roche, Mannheim, Germany) and Lipofectin 2000 (Invitrogen Life Technologies) was applied for PC3 and LNCaP cells, respectively, according to manufacturer’s user guides. For transfection of siRNA or antisense OGX-O11, oligofectamine (Invitrogen Life Technologies) was used according to the user guide. GFP–CLU plasmid was generated in the lab8 (link). The siRNAs used in the study were: human CLU: 5′- GCAGCAGAGUCUUCAUCAU -3′ (Dharmacon); scramble: 5′- CAGCGCUGACAACAGUUUCAU -3′ (Dharmacon); and ATG3: 5′- GGAAUCAAAGUUUAAGGAAACAGGU -3′ (Invitrogen Life Technologies). CLU antisense oligonucleotide (ASO) OGX-011 was kindly provided by OncoGenex Pharmaceuticals (Vancouver, BC). The sequence of OGX-011 corresponds to the human CLU translation initiation site in exon ll (5′- CAGCAGCAGAGTCTTCATCAT -3′). A scrambled (ScrB, 5′- CAGCGCTGACAACAGTTTCAT -3′) control oligonucleotide was generously provided by ISIS Pharmaceuticals (Carlsbad, CA).

Zhang F., Kumano M., Beraldi E., Fazli L., Du C., Moore S., Sorensen P., Zoubeidi A, & Gleave M.E. (2014). Clusterin facilitates stress-induced lipidation of LC3 and autophagosome biogenesis to enhance cancer cell survival. Nature Communications, 5, 5775.

+ Open protocol

+ Expand

Intestinal Epithelial Cell NF-κB Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

FHs 74 Int human neonatal intestinal epithelial cells were purchased from ATCC (Manassas, VA). The cells were routinely maintained in Hybri-Care medium (Cat. 46-X; ATCC) contain 10% FBS, 1% of streptomycin and penicillin (Cat. 15240062; Gibco), and 30 ng/ml EGF (Cat. z00333-1; GeneScript). Transfections were carried out using the Lipofectin 2000 (Invitrogen). The conditions of transfection of NF-κB expression vector were optimized (plasmid concentrations, transfection reagent concentration over time, etc.) in the beginning of experiments. Empty vector (pCMV4) was used as a control in all experiments. The transfected cells were washed three time before treatment and incubated in serum-free Hybri-Care media with filtered fermented formula (0–400 μl/ml) or propionic acid (0–5 mM) (cat. A258-500; Fisher scientific) for 18 h.

Roy S.K., Meng Q., Sadowitz B.D., Kollisch-Singule M., Yepuri N., Satalin J., Gatto L.A., Nieman G.F., Cooney R.N, & Clark D. (2018). Enteral administration of bacteria fermented formula in newborn piglets: A high fidelity model for necrotizing enterocolitis (NEC). PLoS ONE, 13(7), e0201172.

+ Open protocol

+ Expand

Stable Transfection of T84 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

T84 cells were stably transfected with either shRNA XRCC2 plasmid (sc-36861-SH, Santa Cruz, Dallas, TX, USA) (shRNA-XRCC2) or control shRNA plasmid-A (sc-108060, Santa Cruz) as scramble shRNA (shRNA-SC), using Lipofectin reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instruction. Briefly, 1 μg of each plasmid DNA and 20 μL of Lipofectin 2000 (Invitrogen) were mixed separately with serum-free Optim-MEM medium (Invitrogen) and incubated for 5 min at room temperature. Then they were combined and incubated for 15 min. After 48 h incubation, individual colonies were selected for resistance to 10 μg/mL puromycin for 2 weeks. Signal colonies were isolated and cultured to obtain stably transfected cells line. The effectiveness of transfection was examined by Western blot.

Wang Q., Wang Y., Du L., Xu C., Sun Y., Yang B., Sun Z., Fu Y., Cai L., Fan S., Fan F, & Liu Q. (2014). shRNA-Mediated XRCC2 Gene Knockdown Efficiently Sensitizes Colon Tumor Cells to X-ray Irradiation in Vitro and in Vivo. International Journal of Molecular Sciences, 15(2), 2157-2171.

+ Open protocol

+ Expand

U2OS Cell Culture and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

U₂OS cells were cultured in dulbecco’s modified eagle medium (DMEM) (Sigma) supplemented with 10% FBS (HyClone) and 1% Penicillin–Streptomycin Solution (Gibco). Cell transfection was performed using Lipofectin 2000 (Invitrogen) or PEI (Polysciences) according to the protocols provided by the manufacturers. Cell lysates were mixed with sodium dodecyl sulfate (SDS) loading buffer (200 mMTris-HCl, pH 6.8, 400 mM dithiothreitol (DTT), 16% β-mercaptoethanol, 8% SDS, 23 loading dye base (Amresco) and 40% glycerol), boiled for 10 min and subjected to SDS–polyacrylamide gel electrophoresis (PAGE) and Western blotting according to standard protocols.

Wang B., Xiao X., Huang F, & Liu R. (2019). Syntaxin-17-Dependent Mitochondrial Dynamics Is Essential for Protection against Oxidative-Stress-Induced Apoptosis. Antioxidants, 8(11), 522.

+ Open protocol

+ Expand

Cell Lysis and Immunoblotting Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

293T and U₂OS cells were cultured in DMEM (Gibco) supplemented with 10% FBS (HyClone) and 1% Penicillin-Streptomycin Solution (Gibco). Tet-approved FBS (Clontech) was used for tetracycline-inducible short hairpin RNA cells. Cell transfection was performed using Lipofectin 2000 (Invitrogen) or PEI (Polysciences) according to protocols provided by manufacturers. Whole-cell lysates used for immunoprecipitation and immunoblotting were prepared in tandem affinity purification buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5% Igepal CA-360, 1 mM NaF, 1 mM Na₃VO₄, 1 mM EDTA and a protease inhibitor mixture) on ice. Unless used for further immunoprecipitation, lysates were mixed with SDS loading buffer (200 mM Tris-HCl, pH 6.8, 400 mM DTT, 16% β-mercaptoethanol, 8% SDS, 2× loading dye base (Amresco) and 40% glycerol), boiled for 10 min and subjected to SDS–PAGE and western blotting according to standard protocols.

Diao J., Liu R., Rong Y., Zhao M., Zhang J., Lai Y., Zhou Q., Wilz L.M., Li J., Vivona S., Pfuetzner R.A., Brunger A.T, & Zhong Q. (2015). ATG14 promotes membrane tethering and fusion of autophagosomes to endolysosomes. Nature, 520(7548), 563-566.

+ Open protocol

+ Expand

Peking Duck Myoblast Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each experiment, Peking duck eggs which were incubated for 13 days were randomly selected, and the duck myoblasts that used were isolated from the leg muscles of embryos [17 (link)]. Cells were cultured in growth medium (GM) containing Dulbecco’s modified Eagle’s medium (DMEM) (Tokyo, Japan), 15% fetal bovine serum (FBS) (Invitrogen, U.S.A.) and antibiotics (100 U/ml penicillin and 100 g/ml streptomycin). Growing myoblasts (70–80% confluent) were transfected with miR-365 mimic (50 nM) by using Lipofectin 2000 (Invitrogen, U.S.A.) according to the manufacturer’s instructions. At 24 h post-transfection, cells were harvested for RNA and protein extraction.

Sun W., Hu S., Hu J., Yang S., Hu B., Qiu J., Gan X., Liu H., Li L, & Wang J. (2019). miR-365 inhibits duck myoblast proliferation by targeting IGF-I via PI3K/Akt pathway. Bioscience Reports, 39(11), BSR20190295.

+ Open protocol

+ Expand

ATG5 Knockdown in Cancer-associated Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

CAFs were infected with concentrated ATG5-knockdown (KD)–eGFP lentivirus or empty control lentivirus vectors (NBFW-lenti-3299; OBIO Company, Shanghai, China), and were then selected and enriched by use of a FACSAria II (BD Biosciences, San Jose, CA, USA). Lipofectin 2000 (Invitrogen) was used for cell transfection.

Zhao X.L., Lin Y., Jiang J., Tang Z., Yang S., Lu L., Liang Y., Liu X., Tan J., Hu X.G., Niu Q., Fu W.J., Yan Z.X., Guo D.Y., Ping Y.F., Wang J.M., Zhang X., Kung H.F., Bian X.W, & Yao X.H. (2017). High-mobility group box 1 released by autophagic cancer-associated fibroblasts maintains the stemness of luminal breast cancer cells. The Journal of pathology, 243(3), 376-389.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!