Abi 3500xl dna sequencer

Recombinant human wild-type liver GCK was constructed with a His tag at the NH2 terminal and ligated into the pET-28a(+) vector. The Ala259Thr mutation was generated based on the His-GCK construct by PCR using a kit (QuikChange II Site-Directed Mutagenesis Kit, Stratagene, CA, USA). The following oligonucleotide was used to generate the Ala259Thr mutation: forward primer (5’ CGAGTGGGGCACCTTCGGGGACTCCGGCGAGCTGGACGAGTT 3’) and reverse primer (TCCCCGAAGGTGCCCCACTCGGTATTGACGCACATGCGGCCCT). The wild-type and mutant GCK sequences were verified using the ABI 3500xl DNA sequencer (Applied Biosystems, USA). The wild-type and mutant GCKs with His tags were transformed into E. coli (BL21-CodonPlus (DE3)-RIPL chemically competent cells) and then purified from 30-g cell pellet. Two-step affinity chromatography was used with Ni-NTA beads to bind the fusion protein, which was eluted with Ni-NTA and loaded onto the Superdex™ 200 16/60 column. Both the wild-type and mutant His-GCK purified proteins showed a single band on SDS-PAGE gels. The purified proteins were quantified using the Bradford method (Bradford Protein Assays, Thermo Fisher Scientific, USA) using standard methods and stored at -80°C in 30% glycerol, 5 mmol/L glutathione, 5 mmol/L dithiothreitol (DTT), 200 mmol/L KCl, and 50 mmol/L Tris buffer (pH 7.4).

The t(14;18) was amplified by nested PCR adapting the method of Gribben et al.^{32 (link)} using two BCL2 primers directed at major breakpoint region (MBR) and minor cluster region (mcr) in chromosome 18 and a consensus primer directed to J_H in chromosome 14. The J_H internal primer was marked with a fluorochrome for detecting BCL2 translocation size by GeneScan with an ABI 3500xL DNA Sequencer (Applied Biosystems).