Pgl4.10 plasmid

For the WT version, the TFEB promoter sequence was cloned into PGL4.10 plasmid (Promega) downstream of the firefly luciferase (FLuc) ORF. A mutant derivative mutated for predicted EGR1 binding sites (mut) was synthesized (GeneScript). A plasmid encoding for the Renilla luciferase gene (pRL-TK, Promega) was cotransfected to normalize for transfection efficiency. PGL4.10 empty plasmid was used as a negative control. FLuc and RLuc activities relative to WT and mut constructs were measured by Dual-Luciferase assay (Promega) 72 hours after transfection, and ratios between FLuc and RLuc were calculated.

To characterize potential effects of this SNP on transcription, we used PCR to amplify a 1.7 kb genomic region spanning from 1530 bps upstream of the human GRIN2B gene transcription start site into GRIN2B gene untranslated exon 4. Exon organization was based on RefSeqGene NG_031854.1 (Fig. S1, Panel A Supplementary Material). For PCR, the Forward primer: 5′ GAGCTCAAACCACTTCCTCCGGCTTC 3′ and the Reverse primer: 5′ CTCGAGGCCAACCTCTAGACGGACA 3′. Individuals with genotype GG and AA are selected to PCR amplify the 1.7kb region for cloning. The PCR product was inserted into the pGL 4.10 plasmid (Promega, Madison, WI, USA) that is a promoter-less vector containing a luciferase reporter gene. Four plasmid constructs were designed, one for each combination of alleles (A or G allele, positive and negative orientation), and the DNA strand transcribed: (1) positive orientation with allele A on the upper transcribed strand (A+ plasmid), (2) positive orientation with allele G (G+ plasmid), (3) negative orientation with allele A on the lower untranscribed strand (A- plasmid), and (4) negative orientation with allele G (G- plasmid). Orientations and alleles in the constructs were confirmed by direct sequencing with an ABI 310 genetic sequencer (Applied Biosystems, Foster City, CA, USA).

The luciferase reporter plasmids PGK-FL-let-7-3xP-BGHpA, PGK-FL-let-7-4xB-BGHpA, and PGK-FL-miR-30-4xB-BGHpA used to produce reporter cell lines for HTS were built stepwise on the HindIII-AflII pEGFP-N2 (Clontech) backbone fragment using PCR-amplified fragments carrying appropriate restriction sites at their termini. First, we produced a basic firefly luciferase reporter composed of PCR-amplified fragments. The PGK promoter sequence was amplified from the phRL_PGK plasmid (Ma et al., 2010 (link)), the firefly luciferase coding sequence was obtained from the pGL4.10 plasmid (Promega), the BGHpA sequence from the pcDNA3.1(–) plasmid (Invitrogen), and a synthetic polyA signal (SpA) sequence upstream of the PGK promoter was taken from the pGL4.10 plasmid. PCR primers used in the cloning are listed in Table S1. Finally, the miRNA binding sites were inserted into the plasmid using in vitro synthesized oligonucleotides carrying miRNA binding sites for let-7 or miR-30 miRNA, which were annealed and cloned into a BamHI site downstream of the luciferase CDS; the plasmids were validated by sequencing. The pGL4_SV40_1xmiR-30P plasmid was generated by inserting the fragment with the miR-30 1xP binding site from phRL_SV40_1xmiR-30P (Ma et al., 2010 (link)) into pGL4_SV40 using XbaI and ApoI restriction sites.