Fluorophore conjugated tyramide

For fluorescent whole mount in situ hybridization (FISH), we followed the protocol outlined in (69 (link)). Triple FISH was performed as described in (70 (link)). Signal was developed with fluorophore-conjugated tyramide (1:400 reagent diluents, Perkin Elmer). Labeled probes were transcribed from linearized DNA using digoxigenin-11-UTP, fluorescein-12-UTP (Roche, Indianapolis, IN, USA), or labeled with DNP (Mirus, Madison, WI, USA) following kit instructions. SpLox, SpBrn1/2/4, SpSoxC, SpPtf1a, and SpMist probes were made as previously published [SpLox (71 (link)), SpBrn1/2/4 (25 (link)), SpSoxC (69 (link)) SpPtf1a, and SpMist (53 (link))]. SpIsl, SpNgn and SpNeuroD probes were synthetized using the following primers: SpIsl-F: 5′-CGTGGACCAGACAGACTTGA-3′; SpIsl-R: 5′-AGTCGCTGAGTGCTTTCCAT-3′; SpNgn-F: 5′-TACGACAATGATGCCCAAGA-3′; SpNgn-R: 5′-CCGTTTCACAAAGCCATTTT-3′; SpNeuroD-F: 5′-CTCGCCACCTGATCTCTAC-3′; SpNeuroD-R: 5′-TTCCCGCCTTTCAAAATATG-3′. SpANP2 probe was made as published in Woods et al. 2018. Templates of all the probes were sequenced prior to probe generation and cloned in the pGEM®-T Easy Vector (Promega, Madison, WI, USA). Samples were imaged with a Zeiss 510 Meta confocal microscope.

For fluorescent whole mount in situ hybridization (FISH), we followed the protocol outlined in Cole et al. 2009 with the modification described in [30 (link)]. Signal was developed with fluorophore-conjugated tyramide (1:400 reagent diluents, Perkin Elmer) following instructions. For all the genes, labeled probes were transcribed from linearized DNA as described in [31 ]. SpmiR-375 probe has been synthesized and DIG labelled from Exiqon, and the sequence is: 5’/DigN/TGACGCGAGCCGAACGAACAAA/3’DigN/. The double FISH procedure for SpCpa2L and SpmiR-375 was performed as cited with the only exception that the miRNA probe concentration was 0025 pmol/μl and the samples were hybridized 5 days at 42 °C. mir375 probe has already been used by Christodoulou et al. 2010. Primers used to amplify the riboprobes are summarized in Additional file 1. Templates of all the probes were sequenced prior to probe generation and cloned in the pGEM®-T Easy Vector (Promega, Madison, WI, USA). Sense probes were synthesized to test the specificity of the antisense probe signal. FISH was imaged with a Zeiss 510 Meta confocal microscope.