To detect EGFR gene expression level, cells were harvested after being treated with aX-Td@bsiRNA, free siRNA, and lipo3000@siRNA for 48 h. Total RNA was extracted from cells using RNeasy Mini Kit (QIAGEN, Germany), then reverse-transcribed with HiScript® Q Select RT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech Co., Ltd., Nanjing, China) to obtain cDNAs. Real-time PCR was performed using SYBR® Premix Ex Taq™ II (Tli RNaseH Plus), ROX Plus (TAKARA, Dalian, China) and amplified with Applied Biosystems Stepone™ (Thermo Fisher Scientific, USA). All samples’ EGFR mRNA expression levels were normalized by β-actin amplification. Primer sequences used for EGFR (forward 5ʹ-AGACGCAGATAGTCGCCCAAAG-3ʹ, reverse 5ʹ-TCCATCAGGGCACGGTAGAAG-3ʹ) were designed and synthesized by TAKARA (Dalian, China). β-Actin (forward 5ʹ-AAATCGTGCGTGACATTAA-3ʹ, reverse 5ʹ-CTCGTCATACTCCTGCTTG-3ʹ)38 (link) was synthesized by TAKARA (Dalian, China).
Hiscript q select rt supermix for qpcr gdna wiper
Manufactured by Vazyme
Sourced in China
HiScript Q Select RT SuperMix for qPCR (+gDNA wiper) is a reverse transcription and real-time PCR reagent kit designed for sensitive and specific quantification of RNA targets. It includes a gDNA wiper component for efficient removal of genomic DNA contamination.
Automatically generated - may contain errors
Lab products found in correlation
Chamq universal sybr qpcr master mix, by Vazyme (2 mentions)
Applied biosystems stepone, by Thermo Fisher Scientific (1 mentions)
β actin, by Takara Bio (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Sybr green qpcr super mix kit, by Vazyme (1 mentions)
Rna subcellular isolation kit, by Active Motif (1 mentions)
Mx3005p quantitative pcr system, by Agilent Technologies (1 mentions)
Qtower 2.2 system, by Analytik Jena (1 mentions)
Sybr green rt pcr kit, by Takara Bio (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
6 protocols using hiscript q select rt supermix for qpcr gdna wiper
1
EGFR Gene Expression Quantification
2
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues using TRIzol according to the manufacturer’s protocol. Nuclear and cytoplasmic RNA were isolated from cells using RNA Subcellular Isolation Kit (Active Motif, Shanghai, China). cDNA synthesis was performed using a HiScript Q Select RT SuperMix for qPCR (+ gDNA wiper) (Vazyme Biotech Co., Nanjing, China). qRT-PCR analysis was performed using SYBR Green qPCR SuperMix Kit (Vazyme Biotech Co., Nanjing, China) according to the manufacturer’s protocol. The expression of the target genes was normalized to that of GAPDH. The primers used for amplification are described in Supplemental Materials and Methods .
3
Quantitative RT-PCR Analysis of Viral RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A two-step real-time quantitative RT-PCR was used to examine specific mRNA levels. Cells were lysed for quantitative reverse transcription-PCR (qRT-PCR), and total RNA was extracted according to the manufacturer’s instructions (Easy-do Bio, Zhejiang, China). Reverse transcription was carried out with HiScript Q Select RT SuperMix for qPCR (+gDNA wiper; Vazyme, Nanjing, China). To detect the viral NP mRNA, we used oligo(dT) primer for the reverse transcription. And to detect the viral NP cRNA and vRNA, we used primer specifically targeting IAV H9N2 JSC1 cRNA and vRNA for reverse transcription. Quantitative PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China), and run on an Mx3005P quantitative PCR system(Agilent, California, US). The primers of RT-PCR were designed using PrimerQuest Tool. The sequences of primers for qRT-PCR are listed in Table 3 . Each gene was amplified in triplicate, and the mean threshold (Ct) values were calculated. GAPDH was used for normalization in gene expression analysis. Relative fold changes in gene expression among groups were determined using the 2−ΔΔCt method.
4
Quantifying yceI Expression in Ralstonia solanacearum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR analysis was used to determine the expression levels of yceI under MG treatment. The growth condition of R. solanacearum and mRNA preparation method were referred to in a previous study [21 ]. The total RNA was reverse transcribed with HiScript Q Select RT SuperMix for qPCR +gDNA wiper (Vazyme, Nanjing, China). The qRT-PCR was conducted using the SYBR Green RT-PCR Kit (Takara, Kusatsu, Japan) on a qTower 2.2 system (AnalytikJena, Jena, Germany) with the specific primers 5′-GGCTCCACCAAAATCAAGCG-3′ and 5′-CCAGCGCAATGTTCAGATCG-3′. The 16s rRNA gene was used as an internal reference with the specific primers 5′-ATGCCACTAACGAAGCAGAGA-3′ and 5′-TTGCGGGACTTAACCCAAC-3′. Each sample was subjected to three independent PCRs (biological replicates), and each PCR reaction was performed in triplicate (technical replicates). The results were calculated using the 2−ΔΔT method [28 ]. The expression of yceI in R. solanacearum not treated with MG was regarded as a standard to determine the relative expression of yceI in R. solanacearum under MG treatment.
5
Quantitative Real-Time PCR for MSRV Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR was performed using CFX96 Real-Time PCR Detection System (Bio-Rad, USA). The total RNA was isolated using an RNAex Pro reagent (Accurate Biology) (Hunan, China). The total RNA was reverse transcribed at 50 °C for 15 min and 85 °C for 2 min using HiScript Q Select RT SuperMix for qPCR (+gDNA wiper) (Vazyme) (Nanjing, China) to obtain the cDNA. The program for the PCR reactions was: 95 °C for 5 min followed by 39 cycles of 95 °C for 15 s, 60 °C for 60 s. The primers for real-time PCR are presented in Table 1 . At the end of the real-time PCR, the CT value of each reaction was provided and the changes in the transcriptional level of the target genes normalized to β-actin were calculated by the following formula: Relative mRNA level of target gene (folds of control) = 2−ΔΔCT.Table 1
Primers used for the analysis of mRNA expression by qRT-PCR.
| Genes | Primer sequences (from 5’ to 3’) | Refs. | |
|---|---|---|---|
| MSRV nucleoprotein (N) | Forward | GCCCACATCGCATCATTCAC | Shen et al. (2020) |
| Reverse | GTGGCAGAGTAAGGGGACAC | ||
| MSRV glycoprotein (G) | Forward | TGTCAATGTGCGGAGAGGTG | Yang et al. (2021) |
| Reverse | TGTGATACGTAGCTGAGCCG | ||
| β-actin (GCO cells) | Forward | GATGATGAAATTGCCGCACTG | Yang et al. (2021) |
| Reverse | ACCGACCATGACGCCCTGATGT | ||
| β-actin (Largemouth bass) | Forward | CCACCACAGCCGAGAGGGAA | Yang et al. (2021) |
| Reverse | TCATGGTGGATGGGGCCAGG |
6
Validation of Differentially Expressed Genes in Rhizoctonia solani
Check if the same lab product or an alternative is used in the 5 most similar protocols
R. solani AG1IA culture and total RNA isolation were performed using the methods described in treatment of transcriptome samples and RNA isolation of R. solani AG1IA. Reverse transcription was performed with 100 ng of total RNA using HiScript Q Select RT SuperMix for qPCR (+gDNA wiper) (Vazyme). Using reverse transcribed products as templates, quantitative real-time PCR (qRT-PCR) was then performed using ChamQTM Universal SYBR® qPCR Master Mix (Vazyme) on a qTOWER 2.2 instrument (Germany). Gene-specific primers were designed using Primer Premier 6.0 software. Using 18S rRNA as an endogenous reference, ten genes that differed significantly were randomly chosen for primer design and qRT-PCR validation. The tested genes and primers are displayed inSupplementary Table 1
+ Expand
R. solani AG1IA culture and total RNA isolation were performed using the methods described in treatment of transcriptome samples and RNA isolation of R. solani AG1IA. Reverse transcription was performed with 100 ng of total RNA using HiScript Q Select RT SuperMix for qPCR (+gDNA wiper) (Vazyme). Using reverse transcribed products as templates, quantitative real-time PCR (qRT-PCR) was then performed using ChamQTM Universal SYBR® qPCR Master Mix (Vazyme) on a qTOWER 2.2 instrument (Germany). Gene-specific primers were designed using Primer Premier 6.0 software. Using 18S rRNA as an endogenous reference, ten genes that differed significantly were randomly chosen for primer design and qRT-PCR validation. The tested genes and primers are displayed in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!