Cy5.5 NHS ester was bought from GE Healthcare (Piscataway, USA). 3-aminopropylmethyldimethoxysilane (APTMS), N-[(3-trimethoxysilyl) propyl] ethylenediamine triacetic acid trisodium salt (TMS-EDTA), n-hexanol, cyclohexane, Triton X-100, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), ammonium hydroxide (NH4OH), tetraethyl orthosilicate (TEOS), and N-hydroxysulfosuccinimide sodium salt (NHS) were purchased from Sigma Chemical (St. Louis, USA). Yeast tRNA and BSA were provided by Fisher Scientific (Thermo Fisher Scientific Inc., USA). The DNA Sequences used in this work were bought from Sangon Biotech (Shanghai, China), and listed in Supplementary Table S1 .
Cy5.5 nhs ester
Manufactured by GE Healthcare
Sourced in United States
Cy5.5 NHS ester is a fluorescent dye compound used in various bioanalytical techniques. It contains a succinimidyl ester group that can covalently bind to primary amine groups on biomolecules, enabling their detection and labeling.
Automatically generated - may contain errors
Lab products found in correlation
Cy5.5 dmpe, by GE Healthcare (2 mentions)
1 2 dimyristoyl sn glycero 3 phosphatidylcholine, by Avanti Polar Lipids (2 mentions)
1 myristoyl 2 hydroxy sn glycero phosphocholine, by Avanti Polar Lipids (2 mentions)
Gadolinium dtpa dmpe, by Avanti Polar Lipids (2 mentions)
1 ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride, by Merck Group (1 mentions)
N hydroxysulfosuccinimide sodium salt nhs, by Merck Group (1 mentions)
Tetraethyl orthosilicate teos, by Merck Group (1 mentions)
Glen pakdna purification cartridge, by Glen Research (1 mentions)
Q tof premier uplc system, by Waters Corporation (1 mentions)
Ivis 200, by PerkinElmer (1 mentions)
Cy5 nhs ester, by GE Healthcare (1 mentions)
Cy3b nhs ester, by GE Healthcare (1 mentions)
Atto655 nhs ester, by ATTO-TEC (1 mentions)
Cf633, by Biotium (1 mentions)
Dylight 650, by Thermo Fisher Scientific (1 mentions)
Alexa fluor 680, by Thermo Fisher Scientific (1 mentions)
Bg nh2, by New England Biolabs (1 mentions)
Alexa fluor 647, by New England Biolabs (1 mentions)
Cf660c, by Biotium (1 mentions)
Alexa fluor 647, by Thermo Fisher Scientific (1 mentions)
10 protocols using cy5.5 nhs ester
1
Functionalized Silica Nanoparticles for Targeted Delivery
2
Synthesis of Simvastatin-Loaded rHDL Nanoparticles
3
Synthesis and Purification of Fluorescent MALAT1 ASO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single strand 20-base DNA sequences were modified as phosphorothioates (Shanghai Integrated Biotech Solutions Co., Ltd, China), and the base sequence used was as follows: GGGAGTTACTTGCCAACTTG (MALAT1 ASO) [13 (link)]. The Cy5.5 NHS ester was purchased from GE Healthcare Bioscience/GE. The Glen-Pak DNA purification cartridge was obtained from Glen Research (Sterling, VA). Triethylammonium acetate solution (2 M, TEAA), pH 7.0, was purchased from Glen Research (Sterling, VA). All other chemicals were from Sigma-Aldrich (St. Louis, MO).
The HPLC system was equipped with a quaternary pump, variable wavelength detector, vacuum degasser, and ChemStation for system control and chromatography analysis. HPLC was performed using a C18 column (Zorbax ODS 4.6 * 250 mm). For the HPLC linear gradient, the following buffers were used: A, 2% acetonitrile in 0.1 M TEAA, pH 7; B, 50% acetonitrile in 0.1 M TEAA, pH 7. The column was eluted at 1 mL/min at room temperature. Mass spectra were obtained on a Q-Tof premier-UPLC system equipped with an electrospray interface (ESI) (Waters, USA). The product was collected, lyophilised, and stored in the dark at -20°C until use.
The HPLC system was equipped with a quaternary pump, variable wavelength detector, vacuum degasser, and ChemStation for system control and chromatography analysis. HPLC was performed using a C18 column (Zorbax ODS 4.6 * 250 mm). For the HPLC linear gradient, the following buffers were used: A, 2% acetonitrile in 0.1 M TEAA, pH 7; B, 50% acetonitrile in 0.1 M TEAA, pH 7. The column was eluted at 1 mL/min at room temperature. Mass spectra were obtained on a Q-Tof premier-UPLC system equipped with an electrospray interface (ESI) (Waters, USA). The product was collected, lyophilised, and stored in the dark at -20°C until use.
4
Multimodal Imaging of Biological Processes
5
In vivo Biodistribution of QBKPN
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The National Research Council (NRC) of Canada performed the in vivo biodistribution studies. Labelling of the microbial-based product, QBKPN, was carried out using Cy5.5 NHSester (GE Healthcare Life Sciences). All optical imaging experiments were performed using a small-animal time-domain eXplore Optix MX2 pre-clinical imager, and images were analyzed or reconstructed as fluorescence concentration maps using ART Optix Optiview analysis software 2.0 (Advanced Research Technologies, Montreal, QC). The pharmokinetic studies were conducted by collecting blood samples, approximately 0.08 mL, from the submandibular vein at selected time points (from 10 minutes to 96 hours after administration) using three mice.
6
Synthesis and Characterization of Dextran-Dye Conjugates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 1
1.4 μmol of TO-NHS ester (synthesized according to the procedures in Garanger E, Hilderbrand S A, et al., Chem Commun (Camb). 2009: 4444-6) was prepared in 100 μl anhydrous DMSO, and added immediately to 5.4 mg of amino-dextran 40 kDa (Thermo Fisher Scientific, Waltham, Mass.) in 0.4 ml 1×DPBS. The reaction was incubated at 37° C. for 3 hours. After the solution had cooled down to room temperature, it was loaded on a PD-10 column, and eluted with 1 mM phosphate buffer (pH 7.0). The final product was collected and reconstituted into 1 mM phosphate buffer (2 ml). A light red powder was obtained after lyophilization. Dex-Cy5.5 was similarly synthesized by conjugating amino-dextran to Cy5.5-NHS ester (GE Healthcare, Little Chalfont, UK). A light blue powder was obtained after lyophilization.
7
Fluorescent Labeling of rHF Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For fluorescence imaging, Cy5.5 was used to label rHF protein nanoparticles. Cy5.5 N-hydroxysuccinimide (NHS) ester (Cy5.5 NHS ester, GE Healthcare, USA) was incubated with rHF nanoparticles in sodium bicarbonate (0.1 M, pH 8.5) at the molar ratio of 10 Cy5.5 per rHF nanoparticle for 12 h. Subsequently, the mixture was purified on PD-10 SephadexTM G-25 columns in PBS at pH 7.4 to remove free Cy5.5 dye and concentrated by ultrafiltration (MW cutoff 100 kDa, Millipore, Germany).
8
Conjugation of Fluorescent Dyes with BG-NH2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Benzylguanine-conjugated Alexa Fluor 647 (#S9136S) and benzylguanine-conjugated Dyomics 649P1 (#S9159S) were purchased from New England BioLabs. Alexa Fluor 647 (#A20006), Alexa Fluor 680 (#A20008) and DyLight 650 (#62265) conjugated with succinimidyl ester (NHS ester) were purchased from Thermo Scientific. Atto 647N NHS ester (#18373) and Atto 655 NHS ester (#76245) were purchased from ATTO-TEC. Cy3B NHS ester (#PA63101), Cy5 NHS ester (#PA15101), and Cy5.5 NHS ester (#PA15601) were purchased from GE Healthcare. CF633 (#92133), CF647 (#92135), CF660C (#92137), and CF660R (#92134) conjugated with NHS ester were purchased from Biotium. Dyomics 654 conjugated with NHS ester (#654-01) was purchased from Dyomics (Jena). Each dye with NHS ester was reacted with BG-NH2 (#S9148S, New England Biolabs) in anhydrous dimethylformamide (DMF, #227056, Sigma-Aldrich) at 30 °C overnight according to the manufacturer's instructions (New England Biolabs).
9
Synthesis of Simvastatin-Loaded rHDL Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The synthesis of [S]-rHDL was modified from a published method32 . Briefly, simvastatin (AKscentific), 1-myristoyl-2-hydroxy-sn-glycero-phosphocholine (MHPC) and 1, 2-dimyristoyl-sn-glycero-3-phosphatidylcholine (DMPC) (both purchased from Avanti Polar Lipids) were dissolved in chloroform/methanol (4:1 by volume) solvent and dried to form thin film. Human apolipoprotein A1 proteins (ApoA-1) (CSL, Parkville, Australia) dissolved in PBS was added to the film and the solution was incubated in 37°C till the film was hydrated and a homogenous solution was formed. The solution was sonicated to form small [S]-rHDL nanoparticles. Aggregates were removed by centrifugation and filtration. Gadolinium-DTPA-DMPE (Avanti Polar Lipids), Cy5.5-DMPE (DMPE was conjugated with Cy5.5 NHS-ester purchased from GE healthcare), DiR or DiO (Invitrogen) were added when the nanoparticles were subsequently used for imaging purposes. Control rHDL nanoparticles without simvastatin were synthesized with the same procedures.
10
Cy5.5-NHS Ester and Doxorubicin Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Unless otherwise noted, all solvents and compounds were purchased from Aldrich Chemical Co. (St. Louis, MO, USA). Cy5.5-NHS ester was purchased from GE Healthcare Life Science (Piscataway, NJ, USA). Doxorubicin (Adriamycin) was purchased from Doxil (ALZA Corporation, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!