The largest database of trusted experimental protocols

Pmission vsv g

Manufactured by Merck Group
Sourced in Singapore

PMISSION VSV-G is a lentiviral packaging system designed for the production of high-titer lentiviral particles. It contains the essential components for lentiviral particle assembly and pseudotyping with the VSV-G envelope protein, which facilitates efficient transduction of a wide range of cell types.

Automatically generated - may contain errors

5 protocols using pmission vsv g

1

Cell Line Authentication and Genetic Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
All cell lines were authenticated in 2014 by Short Tandem Repeat DNA Profiling (Promega; Fitchburg, WI) at the University of Colorado Cancer Center (UCCC) Tissue Culture Core, and testing for mycoplasma was performed every three months. Only cells under five passages were used in this study. SUM159PT cells were purchased from the UCCC Tissue Culture Core in 2013 and were grown in Ham’s F-12 with 5% fetal bovine serum (FBS), penicillin/streptomycin (P/S), hydrocortisone, insulin, HEPES and L-glutamine supplementation. BT549 cells, purchased from the ATCC in 2008, were grown in RPMI Medium 1640 with 10% FBS, P/S and insulin. MDA-MB-453 (MDA453) cells, purchased from ATCC in 2012, were grown in DMEM Medium with 10% FBS and P/S.
SUM159PT-TGL cells were generated by stable retroviral transduction with a SFG-NES-TGL vector, encoding a triple fusion of thymidine kinase, green fluorescent protein and luciferase and sorted for green fluorescent protein. SUM159PT and MDA453 AR knockdown cells were generated by lentiviral transduction of shRNAs targeting AR (pMISSION VSV-G, Sigma Aldrich; St Louis, MO), including AR shRNA 3715 (shAR15) and AR shRNA 3717 (shAR17). Lentiviral transduction of pMISSION shRNA NEG (shNEG) was used as a non-targeting control. Plasmids were purchased from the University of Colorado Functional Genomics Core Facility.
+ Open protocol
+ Expand
2

Lentiviral shRNA Knockdown of ALKBH5

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus for the short hairpin RNA (shRNA)-mediated knockdown of ALKBH5 was generated by co-transfection of HEK293T cells with a pLKO.1-vector or pLKO.1-vector carrying specific shRNA together with the packaging vector pMISSION-GAG-POL and a vesicular stomatitis virus G protein expressing vector pMISSION-VSV-G. pLKO.1 was purchased from Sigma-Aldrich (SHC001). Two days post-transfection, lentivirus-containing supernatants were harvested, centrifuged to remove cellular debris, and filtered with a 0.45-um filter. Lentivirus production efficiency was determined in parallel using a GFP overexpression lentivirus vector. C33A2 cells were inoculated with stocks of recombinant lentiviruses by centrifugation at 2000 g for 2 h at room temperature in the presence of 10 lg/ml polybrene (Fisher Scientific). Empty pLKO.1-vector was used as negative control. Cells were then resuspended and grown in normal RPMI media for 2 days, after which transduced cells were selected in the presence of puromycin (1 ug/ml). Cells were either harvested for Western blotting or for RNA extraction and RT-PCR.
+ Open protocol
+ Expand
3

Lentiviral shRNA Knockdown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral shRNA vectors (pLKO.1) were either purchased from Sigma or assembled by cloning the shRNA hairpin loop sequence into the AgeI/EcoRI sites of the empty vector. The target sequence for the ZRSR2 shRNAs sh1 and sh2 are 5’-CAACAGTTCCTAGACTTCTAT-3’ and 5’-AGCAGCCCTTTCTCTGTTTAA-3’, respectively. MISSION pLKO.1-puro Non-Mammalian shRNA Control (SHC002; Sigma) was used as control vector for transduction. To generate lentiviral particles, 293T cells (kindly provided by Dr. Bing Lim, Genome Institute of Singapore, Singapore) were co-transfected with shRNA plasmid and the packaging plasmids, pMISSIONgagpol and pMISSIONvsvg (Sigma) using Lipofectamine 2000 (Invitrogen). Virus containing supernatant was collected after 48 and 72 hours, filtered through 0.45 μm filter and stored in aliquots at −80°C. TF-1 and K562 cells (American Type Culture Collection) were infected with lentivirus for 2 rounds, 24 hours apart, in the presence of 5 μg/ml protamine sulfate. Transduced cells were selected in puromycin to generate stable knockdown cell lines. The knockdown was verified using qPCR and western blotting.
+ Open protocol
+ Expand
4

Lentivirus Production for shRNA Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
To obtain lentivirus supernatants, HEK293T cells were transiently transfected with pLKO.1-puro-CMV-tGFP containing shRNA sequences (Sigma-Aldrich Japan), pMISSION GAG POL (Sigma-Aldrich Japan), and pMISSION VSV-G (Sigma-Aldrich Japan). Forty-eight hours later, the viral supernatant was collected and utilized for infection. The vector-transduced cells were selected by medium containing puromycin (1.0 μg/mL for HL60 and 2.5 μg/mL for primary samples) and subjected to assays in vitro. Non-target shRNA was a nonfunctional construct purchased from Sigma-Aldrich Japan. The target sequences, from 5′ to 3′, were GGGCCTGGAGATTTGGAATAG (ADAM8sh_1) and GGAATAGTCAGGACAGGTTCC (ADAM8sh_2).
+ Open protocol
+ Expand
5

Lentiviral shRNA Knockdown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral shRNA vectors (pLKO.1) were either purchased from Sigma or assembled by cloning the shRNA hairpin loop sequence into the AgeI/EcoRI sites of the empty vector. The target sequence for the ZRSR2 shRNAs sh1 and sh2 are 5’-CAACAGTTCCTAGACTTCTAT-3’ and 5’-AGCAGCCCTTTCTCTGTTTAA-3’, respectively. MISSION pLKO.1-puro Non-Mammalian shRNA Control (SHC002; Sigma) was used as control vector for transduction. To generate lentiviral particles, 293T cells (kindly provided by Dr. Bing Lim, Genome Institute of Singapore, Singapore) were co-transfected with shRNA plasmid and the packaging plasmids, pMISSIONgagpol and pMISSIONvsvg (Sigma) using Lipofectamine 2000 (Invitrogen). Virus containing supernatant was collected after 48 and 72 hours, filtered through 0.45 μm filter and stored in aliquots at −80°C. TF-1 and K562 cells (American Type Culture Collection) were infected with lentivirus for 2 rounds, 24 hours apart, in the presence of 5 μg/ml protamine sulfate. Transduced cells were selected in puromycin to generate stable knockdown cell lines. The knockdown was verified using qPCR and western blotting.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!