Total RNA was extracted using Trizol reagent (Invitrogen). Reverse transcription reaction kit (Takara, Japan) was used for the synthesis of the cDNA. The operation is carried out according to the manufacturer's instructions. The real‐time fluorescent quantitative polymerase chain reaction was performed by ABI 7500 systems. Relative gene expression was calculated using 2(‐ΔΔCt) (Livak). Each experiment was repeated three times.
Reverse transcription reaction kit
Manufactured by Takara Bio
Sourced in Japan
The Reverse Transcription Reaction Kit is a laboratory tool designed to convert RNA into complementary DNA (cDNA) molecules. This kit provides the necessary reagents and enzymes to perform this essential RNA-to-DNA conversion process, which is a fundamental step in various molecular biology and gene expression analyses.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Sybr premix dimereraser, by Takara Bio (2 mentions)
Lightcycler 480 pcr system, by Roche (2 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Total rna extraction reagent, by Promega (1 mentions)
Abi7500 quantitative pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr kit, by Takara Bio (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Recombinant dnase 1 rnase free, by Takara Bio (1 mentions)
Cck 8, by Beyotime (1 mentions)
10 protocols using reverse transcription reaction kit
1
Trizol-based RNA Extraction and RT-qPCR
2
Aorta RNA Extraction and Primer Design
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the aorta specimens with Trizol (Invitrogen) for cDNA synthesis by using a reverse transcription reaction kit (TaKaRa). Table 1 shows the primers for ICAM-1, LOX-1, NOX2, NOX4, and β-actin.
3
Quantitative Analysis of CircCCT3 and miR-613
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by TRIzol (Invitrogen, Carlsbad) reagent, and cDNA was synthesized using a reverse transcription reaction kit (TaKaRa, Komatsu, Japan) following the manufacturer’s instructions. qRT-PCR was performed by SYBR Premix DimerEraser (TaKaRa) on a LightCycler 480 PCR System (Roche, Rotkreuz, Switzerland). The relative expression of RNAs was calculated by the 2−ΔΔCT method and normalized to U6 or glyceraldehyde phosphate dehydrogenase (GAPDH). Primers are listed as below: CircCCT3 Forward primer: GGACCCAGGATGAAGAGGTT; CircCCT3 Reverse primer: CATTGGGTCCAAAAGCATCT; miR-613 Forward primer: GTGAGTGCGTTTCCAAGTGT; miR-613 Reverse primer: GGGTCCCTTCACACTTGGAA; GAPDH: Forward primer: 5′-ACGCTGCATGTGTCCTTAG-3′; Reverse primer: 5′-GAGCCTCTTATAGCTGTTTG-3′; U6: Forward primer: 5′-CTCGCTTCGGCAGCACA-3′; Reverse primer: 5′-AACGCTTCACGAATTTGCGT-3′. Each sample for qRT-PCR was carried out 3 times and the average result was recorded.
4
Gene Expression via qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of cells was extracted using the TRIzol reagent, and cDNA was synthesized from the total RNA extraction through a reverse transcription reaction kit (TaKaRa, Shiga, Japan) [15 (link)]. The synthesized cDNA was 5-fold diluted to be stored until used as templates for qPCR to detect genes with a primer set (Table 1 ). The relative expression levels of mRNAs were normalized to the housekeeping gene GAPDH by using the 2-ΔCT method.
5
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cells utilizing total RNA extraction reagent (Promega, Madison, Wisconsin, USA), which was then reverse transcribed into cDNA via reverse transcription reaction kit Takara, Japan). qRT-PCR was presented via ABI7500 quantitative PCR system (Applied Biosystems, Warring ton, UK) and SYBR Green PCR Kit (Takara). Relative expression levels were determined with the 2-ΔΔCt method 8 (link). Primers were designed and synthesized by Sangon Biotech (Shanghai, China). Primer sequences were as follows: ZFPM2-AS1: 5'-CAATGGGACTAAGCCAGGCA-3' (forward), 5'-GGGCTCCACCAACAACCATA-3' (reverse); miR-515-5p: 5'-TTCTCCAAAAGAAAGCACTTTCTG-3'; TUSC3: 5'-GGCTCAGTTTGTGGCAGAATC-3' (forward), 5'-CATCGCCTTTCGAAGTTGCT-3' (reverse); GAPDH: 5'-GTCAACGGATTTGGTCTGTATT-3' (forward), 5'-AGTCTTCTGGGTGGCAGTGAT-3' (reverse).
6
Quantitative Real-Time PCR for α5-nAChR Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Twenty-five nanogram total RNA per sample was reverse transcribed by using the Reverse Transcription Reaction Kit (Takara Code: DRR061S) according to the manufacturer's instructions. Quantitative real-time PCR was performed analyzed on the Applied Biosystems 7300 Real-Time PCR System to determine the relative amounts of α5-nAChR and β-actin (internal control) mRNAs expressed. The SYBR Green Supermix was used for all real-time PCR reactions. PCR primers used in this study are as follows: α5-nAChR Forward: GAAACTGAGAGTGGTAGTGGACCAA, Reverse: GGGCTATGAATTTCC AATCTTCAAC; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) forward, 5’-CATGAGAAGTATGACAACAGCCT-3’ and reverse, 5’-AGTCCTTCCACG ATACCAAAGT-3’. The quantitative real-time PCR parameters were 95°C for 10s as a pre-denature step followed by 40 PCR cycles of 95°C for 5 s, 60°C for 30 s and 72°C for 10 min. All the samples were performed in triplicates in each experiment. The relative amount mRNA was calculated using the comparative CT method after normalization to β-actin mRNA levels.
7
Temporal Transcriptome Analysis of Lepidopteran Wings
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole wings were dissected and the pupal cuticle removed on the 4th, 6th, and 8th day after pupation and placed into TRIzol (Invitrogen, USA) after washing with PBS three times. RNA was isolated from wings with TRIzol (Invitrogen, USA) following the manufacturer’s instructions and treated with Recombinant DNase I (RNase-free) (Takara Bio, China) to remove contaminating genomic DNA. Total RNA (2.5 μg) from each sample was used to construct a cDNA library using the instructions for the Reverse-Transcription Reaction Kit (Takara Bio, China). RT-qPCR was performed using SYBR Premix ExTaq II (Takara Bio, China) on an ABI7500 (ABI, USA) with the following program: 95 °C for 3 min followed by 40 cycles of 95 °C for 5 s, and 60 °C for 30 s, with a final cycle of 95 °C for 15 s, 60 °C for 20 s, and 95 °C for 15 s. The expression level of CPs was normalized to the control reference gene SWU22934 (translation initiation factor 4 A)61 (link). RT-qPCR of each selected gene was repeated three times. Primers are listed in Supplementary Table 1 . A dissociation curve analysis was performed for all primer sets to insure each experimental sample yielded a single sharp peak at the melting temperature of the amplicon.
8
Extracting RNA from Tissue and Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from human femoral head tissue, rat femoral head tissue, and HUVECs using TRIzol (Invitrogen, USA) according to the manufacturer's instructions [26 (link)]. cDNA was generated from the total RNA extracted from tissues or cells with a reverse transcription reaction kit (TAKARA, Japan). The cDNA was used as a template for subsequent qPCR assays. The forward and reverse primers used in this study are shown in Table 1 .
9
Circular RNA and miRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by TRIzol (Invitrogen,Carlsbad, CA, USA) reagent and cDNA was synthesized using reverse transcription reaction kit (TaKaRa, Komatsu, Japan) following the instruction. qRT-PCR was performed by SYBR Premix DimerEraser (TaKaRa, Komatsu, Japan) on a LightCycler 480 PCR System (Roche, Rotkreuz,Switzerland). Relative expression of RNAs was calculated by 2 -ΔΔCT method and normalized to U6 or glyceraldehyde phosphate dehydrogenase (GAPDH). Primers are listed as below:CircCCT3 Forward primer: GGACCCAGGATGAAGAGGTT;CircCCT3 Reverse primer: CATTGGGTCCAAAAGCATCT; miR-613 Forward primer: GTGAGTGCGTTTCCAAGTGT; miR-613 Reverse primer: GGGTCCCTTCACACTTGGAA ; GAPDH: Forward primer: 5′-ACGCTGCATGTGTCCTTAG-3′; Reverse primer: 5′-GAGCCTCTTATAGCTGTTTG-3′; U6: Forward primer: 5′-CTCGCTTCGGCAGCACA-3′; Reverse primer: 5′-AACGCTTCACGAATTTGCGT-3′.
CCK-8 assay 2×10 5 cells in each well were inoculated in 96-well plates. Medium was used as blank control. At posthypoxiareoxygenation, indicated cells in per well were added 10 μL of CCK-8 (Beyotime Institute of Biotechnology, Beijing, China) solution, and kept at 37°C for 2 h. The OD value of 450 nm was detected.
The nal data was represented as cell viability.
CCK-8 assay 2×10 5 cells in each well were inoculated in 96-well plates. Medium was used as blank control. At posthypoxiareoxygenation, indicated cells in per well were added 10 μL of CCK-8 (Beyotime Institute of Biotechnology, Beijing, China) solution, and kept at 37°C for 2 h. The OD value of 450 nm was detected.
The nal data was represented as cell viability.
10
RNA Expression Analysis of DEC1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Invitrogen) according to the manufacturer's instructions. Total RNA was reverse transcribed using a Reverse Transcription Reaction Kit (Takara). Real-time polymerase chain reaction (PCR) was performed and analyzed on an Applied Biosystems 7300 Real-Time PCR System to determine the relative amounts of DEC1 and β-actin (internal control) mRNAs expressed. SYBR Green Supermix was used for all real-time PCR reactions. PCR primers used in this study are as follows: DEC1 Forward: ACT TAC CTT GAA GCA TGT GAA AGC A, Reverse: CAT GTC TGG AAA CCT GAG CAGAA; β-actin Forward: TGA CGT GGA CAT CCG CAA AG, Reverse: CTG GAA GGT GGA CAG CGA GG. Real-time PCR parameters were 95 °C for 10 s as a pre-denaturing step followed by 40 PCR cycles of 95 °C for 5 s, 60 °C for 30 s, and 72 °C for 10 min. All samples were assayed in triplicate. The relative amount of mRNA was calculated using the comparative CT method after normalization to β-actin mRNA levels.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!