First strand cDNA libraries were synthesized from total RNA isolated from the embryos of medaka strain i3 with RACE cDNA Amplification Kit (BD BioSciences). The gene encoding proIGF-II was amplified by PCR with primers of IGF2F (GCGTCTGCCATGGAGATCCC) and IGF2R (CAGTTGGTGTTTACTCGCCG). The cloned gene was verified by DNA sequencing. The gene igf2 encoding IGF2 mature peptide was PCR-amplified by using a primer pair of IGF2Nco (GCCATGGGGCTGGCCTCGGCGGAG and IGF2Xho (GCTCGAGTTCCGACTTGGTGGGTT). This PCR product was digested and ligated in-frame within NcoI and XhoI sites of pET32a to generated plasmid pIGF2. To construct plasmid pIGF2gfp expressing EGFP fused IGF2 (IGF2:GFP), the igf2 gene was PCR-amplified with a primer pair of IGF2Nco plus IGF2Hind (GAAGCTTTTCCGACTTGGTGGG) and ligated into pET32a together with an egfp gene amplified with primer pair of GFPhind (GAAGCTTGTGAGCAAGGGCGAGGAG) plus GFPXho (CCTCGAGCTTGTACAGCTCGTCC). Plasmid pGFP was constructed by insertion of a gfp gene within restriction sites of NcoI and XhoI in pET32a, which was PCR-amplified by GFPNco (ACCATGGTGAGCAAGGGCGAGG) plus GFPXho.
Race cdna amplification kit
Manufactured by BD
Sourced in United States, United Kingdom
The RACE cDNA Amplification Kit is a laboratory product designed for rapid amplification of cDNA ends. It provides a simple and efficient method to obtain full-length cDNA sequences from limited RNA samples.
Automatically generated - may contain errors
4 protocols using race cdna amplification kit
1
Medaka IGF2 fusion protein construction
2
Isolating and Cloning Vasa Gene from Testicular RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A cDNA library was synthesized from 3 μg of testicular RNA by using the RACE cDNA Amplification Kit (BD BioSciences). A cDNA fragment of ~750 bp was amplified from the cDNA libraries with degenerate primers corresponding to the conserved amino acid sequences MDDWEEE and MACAQTG. The sequence of this fragment was used to design a gene-specific primer covering the initiation codon (ATGGACGACTGGGAGGAAGAGACTGC, broken underline in Figure 1 ) for 3'-RACE in combination with the SMART library 3' adapter primer (5'-AAGCAGTGGTAACAACGCAGAGTAC(T)30 as described 27 (link). The 3'-RACE product was cloned into pGEM-T. Recombinant plasmids in three colonies were found to contain one and the same insert of 2241 bp as analyzed by sequencing, and thus named pLvasa. Similarly, an 854-bp fragment was amplified from the cDNA library by using a pair of primers (defined by solid underline in Figure 1 ) and cloned, resulting in pLvasa854. Correct cloning was analyzed by test digestion and/or sequencing (see below).
3
Viral Genomic RNA Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the infected mulberry leaves using RNAplant plus reagent (TIANGEN, Beijing, China) according to the manufacturer's instruction and the quality of the purified RNA was evaluated by gel electrophoresis on 0.8% (w/v) agarose gels. The 5′ and 3′-terminal sequences of the viral genomic RNA were determined by using the RACE cDNA Amplification Kit (BD Biosciences, Franklin Lakes, NJ, USA) coupling with Sanger sequencing. Primers were designed according to the available sequences obtained through viral small RNA deep sequencing. The RACE products were purified using DNA gel recovery kit (Sangon, Shanghai, China) and cloned into the pCR2.1-TOPO vector (Thermo Fisher Scientific, Waltham, MA, USA) before sequencing.
4
Venomous Snake Toxin Transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complementary DNA libraries were constructed by reverse transcription of polyadenylated mRNA extracted from 5 mg of lyophilized venom using Dynabeads® M DIRECT TM Kit (Dynal Biotech, UK). A SMART TM Rapid Amplification of cDNA ends (RACE) cDNA Amplification kit (BD Clontech, UK), both 5'-and 3' ends cDNA ends were synthesized using SMART (Switching Mechanism At 5' end of RNA Transcription) cDNA synthesis technology. For the reactions, a nested universal primer (NUP) and degenerated sense primers were applied. Two types of primers were applied: (1) homologous primers designed on the basis of conserved 3'-untranslated region of analogue snake toxins identified from evolutionary related species of the same subfamily Viperinae like Bitis and Echis [15-16] ; (2) degenerated primers for reverse transcription based on the identified protein sequences obtained by MS/MS fragmentation. The obtained cDNA fragments with the expected size were purified and used for transformation of E. coli cells using the pGEM-T vector system for subsequent blue-white screening according to manufacturer's manual (Promega, UK).
After transformation, a PCR of the plasmid DNA obtained from positive E. coli cells was performed, and the PCR fragments were purified with a DNA Extraction kit (RBD Bioscience) for subsequent sequencing using a 3730 DNA sequencer (Applied Biosystems).
After transformation, a PCR of the plasmid DNA obtained from positive E. coli cells was performed, and the PCR fragments were purified with a DNA Extraction kit (RBD Bioscience) for subsequent sequencing using a 3730 DNA sequencer (Applied Biosystems).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!