Accuzol rna extraction kit

Viral RNA was extracted from the samples using AccuZol^TM RNA extraction kit (Bioneer, Korea). PCR was performed using primers specific for the envelope protein-coding gene, KT279065.1. The primers (Bioneer Company, Korea) targeted a 382-bp region in the gene: F, CCGGAAAGAGATCGTACCGT and R, TAAGGAACACAAGCTCGGGG. The AccuPower^® RT-PCR PreMix (Bioneer, Korea) was used with the extracted RNA to obtain the reaction solutions. PCR was performed according to the manufacturer’s instructions. The amplification of the required region of the gene was performed in one tube with the reverse transcription process using the following thermocycler conditions: 50°C for 15 min, 95°C for 5 min, 95°C for 20 s, 58°C for 30 s, 72°C for 1 min, and 72°C for 5 min for one cycle of primary denaturation; 30 cycles of main denaturation, annealing, and main extension; and one cycle of final extension. Electrophoresis was performed using 2% agarose gel stained with ethidium bromide and a 100 volt-80 Amp current. The products were visualized under an ultraviolet-based imager (Vilber Lourmat, France).