Rnase r reaction buffer

Total RNA was extracted from mBMSCs by Trizol reagent. The total RNA was divided into two parts: one for the digestion of RNase R (RNase R+) and the other for the control group with a digestion buffer (RNase R−). For the first part, 2 μg of total RNA with 2 μL of 10 × RNase R Reaction Buffer and 2 μL of RNase R (20 U/μL, Epicentre Biotechnologies, Madison, WI, USA) were mixed; as for the second part, DEPC-treated water was used to replace RNase R. Subsequently, the RNA samples were incubated in 37 °C water for 30 min and then reverse-transcribed into cDNA. To verify the back-spliced events, convergent and divergent primers were designed and synthesized as follows (5′–3′): Circ-Spen (convergent) F: ATATGGCCGCGTGGAAAGTG, Circ-Spen (convergent) R: CTGTCAGTGTTGCTGCTGCTG, Circ-Spen (divergent) F: GCTCCAGGAGTCGATCCTCCA, Circ-Spen (divergent) R: GATGTCCACAAAATCCACAAAGGCA. RT-PCR was performed in ABI 7500 (Thermo Fisher Scientific, Waltham, MA, USA) and the products were verified using Southern blot.

Nuclear and cytoplasmic RNAs were isolated in accordance with PARIS^TM Kit Protein and RNA Isolation System (Qiagen, Valencia, CA, USA). Briefly, cells were treated with trypsin (0.25%), after which centrifugation was carried out at 2000g for 2 min. Then cells pellets were collected, and the nuclear RNA and cytoplasmic RNA were retrieved using NE-PER fractionation buffer (Thermo Fisher Scientific Inc., San Jose, CA, USA) based on the protocols of nuclear and cytoplasmic fraction kit (Qiagen, Valencia, CA, USA) followed by the detection of the concentration of RNA using nano 2000. Afterwards, RNA was resuspended with diethyl phosphorocyanidate (DEPC, 52 μL), followed by the bisection. One part was digested using 3 μL of 10 × RNase R Reaction Buffer and 1 μL of RNase R (20 U/μL) (Epicentre Biotechnologies, Madison, WI, USA), while the other part was added with 1 μL of DEPC and used as control. Both groups were developed at 37° C for 30 min. Subsequently, phenol/chloroform was supplemented to terminate digestion, followed by ethanol precipitation. RNA was reverse-transcribed into cDNA as described before. Circ_0000326 expression in cytoplasm was measured using RT-qPCR.