Lv bancr 540

Recombinant lentiviruses containing short hairpin (sh)RNA-323 (LV-BANCR-323), shRNA-540 (LV-BANCR-540), human full-length BANCR cDNA (LV-BANCR) and negative control (LV-NC) were purchased from GenePharma (Shanghai, China). The HCT116 cells were infected with LV-BANCR-323, LV-BANCR-540 and LV-NC [multiplicity of infection (MOI)=20] and the Caco-2 cells were infected with LV-BANCR and LV-NC (MOI=10). The supernatant was removed after 24 h and replaced with a fresh culture medium. The infection efficiency was confirmed by qPCR 72 h following infection and the cells were treated with 2 μg/ml puromycin for two weeks.

Recombinant lentiviruses containing short hairpin (sh)RNA-323 (LV-BANCR-323, GGA GTGGCGACTATAGCAAAC), shRNA-540 (LV-BANCR-540, GGACTCCATGGCAAACGTTGT), human full-length BANCR cDNA (LV-BANCR) and a negative control (LV-NC) were purchased from GenePharma Co., Ltd. (Shanghai, China). The IHH-4 cells were infected with LV-BANCR-323, LV-BANCR-540, LV-BANCR and LV-NC (multiplicity of infection, 20). The supernatant was removed after 24 h and fresh culture medium was added to the cells. The infection efficiency was confirmed by RT-PCR at 72 h post-infection, and the cells were treated with 2 μg/ml puromycin for 2 weeks.