Pcr topo 2 vector

KSHV viral load was quantified using real-time PCR. KSHV DNA was detected using primers (K6 forward primer K6-10F 5′-CGCCTAATAGCTGCTGCTACGG-3′, K6 reverse primer K6-10R 5′-TGCATCAGCTGCCTAACCCAG-3′) and a probe (K6 probe p-K6-10 5′-R-CACCCACCGCCCGTCCAAATTC-Q-3′) previously reported to be specific to the K6 gene region [25 (link)]. Additionally, the number of cellular equivalents were determined using a quantitative assay specific to human endogenous retrovirus 3 (ERV-3), which is present in two copies per genomic cell, using these primers (ERV-3 Forward primer PHP10-F 5′-CATGGGAAGCAAGGGAACTAATG′ ERV-3 Reverse primer PHP10-R 5′-CCCAGCGAGCAATACAGAATTT-3′) and a probe (ERV-3 Probe PHP-P505 5′-R-TCTTCCCTCGAACCTGCACCATCAAGTCA-Q-3′). To quantify both ERV-3 and KSHV DNA, seven two-fold serial dilutions of K6 and ERV-3 were made from clone stocks (starting with 1 × 10⁶ dilution to 1 × 10⁰) to form a standard curve on every plate. ERV-3 was cloned into Bluescript II KS vector (Stratagene, La Jolla, CA, USA) KSHV K6 cloned using PCR Topo II vector, Topo TA Cloning kit, Invitrogen, K 4600-40. This procedure has been reported elsewhere [10 (link), 26 (link), 27 (link)].

In order to generate a mouse line in which Rag1 and Rag2 expression could be induced from the Rosa26 locus by removal of the STOP cassette upon Cre expression, we used 2A peptides79 (link) for bicistronic expression. We amplified the mouse Rag2 coding region from genomic DNA by PCR reaction with primers (Rag2-5′ and Rag2-2A-3′) which allowed us to add 2A peptide sequences after the stop codon for Rag2 translation. We also amplified Rag1 cDNA by PCR. These PCR products were cloned into the pCR-TOPOII vector (Invitrogen), and their sequences verified. We then inserted the Rag2-2A fragment in front of the Rag1 cDNA fragment in pCR-TOPOII, followed by preparation of an entire Rag2-2A-Rag1 fragment by NotI digestion and a ligation into the NotI site of the pCTV vector (Addgene) (Supp Fig. 2a). The linearized targeting vector was transfected into M1 embryonic stem (ES) cells by electroporation. After G418 selection, ES clones that underwent homologous recombination were screened by PCR as previously described80 (link). Primers: Rag2-5′ (5′- CGGCGCGCC AGCATAATTACCAATATGAAAAGATATTC-3′), Rag2-2A-3′ (5′- CGGATCCCCTGGGCCAGGATTCTCCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCTCCACTGCCATCAAACAGTCTTCTAAGGAAGGATTTC-3′), Rag1-5′ (5′-GGATCCTATGGCTGCCTCCTTGCCGTCTACCCTGAGC-3′) and Rag1-3′ (5′- CGGCGCGCCATGTGGAGATCCTATTTAAAACTCCATTGA -3′).

The VGLUT2 probes used in this study were digoxigenin-labeled riboprobes obtained by in vitro transcription of a rat VGLUT2 cDNA (Gift from Dr S. El Mestikawy). This cDNA (539 bp) was inserted into the pCR-TOPO-II vector (Invitrogen) for in vitro transcription. The transcription was carried out with the nonradioactive RNA labeling kit (Roche Diagnostics, Meylan, France). The recombinant plasmid containing the VGLUT2 cDNA insert was linearized with Xho I and transcribed with Sp6 RNA polymerase to obtain the antisense probe or linearized with Hind III and transcribed with T7 to obtain the sense probe. The labeling efficiency of the digoxigenin-labeled probes for VGLUT2 mRNA was determined each time by direct immunological detection on dot blots with a nucleic acid detection kit (Roche Diagnostics). The intensity of the signal for each probe was compared with a serial dilution of digoxigenin-labeled control RNA of known concentration. Only antisense and sense VGLUT2 probes with comparable signal intensity (comparable labeling efficiency), as determined in dot blots, were used for in situ hybridization.