The largest database of trusted experimental protocols

Hrp conjugated secondary antibody

Manufactured by Zhongshan Biotechnology
Sourced in China

The HRP-conjugated secondary antibody is a laboratory reagent used in various immunoassay techniques. It is a detection antibody that binds to the primary antibody, enabling the amplification of the signal during the detection process. The HRP (Horseradish Peroxidase) enzyme conjugated to the secondary antibody catalyzes a colorimetric or chemiluminescent reaction, allowing for the visualization and quantification of the target analyte.

Automatically generated - may contain errors

12 protocols using hrp conjugated secondary antibody

1

Western Blot Analysis of Protein Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Samples were separated by 10% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes. BCL2L11 and PTEN proteins were detected with anti-BCL2L11 and anti-PTEN rabbit monoclonal Abs (1: 1000; Abcam). CXCL14 proteins were detected with anti-CXCL14 rabbit polyclonal Abs (1:1000; Abcam). Mouse monoclonal GAPDH antibody (1: 2000; Cell Signaling Technology, Beverly, MA, USA) was used as internal reference. HRP-conjugated secondary antibody (1:10000) was purchased from Zhongshan Biotechnology. Bound proteins were visualized by using SuperSignal West Dura Extended Duration Substrate kit (Thermo Scientific, Wilmington, DE, USA).
+ Open protocol
+ Expand
2

Detailed Quantification of lnc-TLN2-4:1 and TLN2

Check if the same lab product or an alternative is used in the 5 most similar protocols
The procedures and reagents of RNA extraction, qRT-PCR, and immunoblotting are described in our previous study [17 (link)]. For qRT-PCR experiments, the expression of lnc-TLN2-4:1 and TLN2 was normalized to an internal control, β-actin, using the 2–ΔΔCt method. The primer sequences are as the follows: TLN2 sense: 5′ACGGCGGAACCAGAGGAGAT3′, TLN2 antisense: 5′GGTGTCCAGGTCGGCAATGAT3′; lnc-TLN2-4:1 sense: 5′GCTGGCTGCTTCTGAGACTTAC3′, lnc-TLN2-4:1 antisense: 5′TGGAGCAACAGACTGAGGACAT3′. The parameter of PCR running is 95°C for 1 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec. For immunoblotting, the anti-TLN2 antibody (ab108967) was purchased from Abcam, China (Shanghai, China), and HRP-conjugated secondary antibody was purchased from Zhongshan Biotechnology (Beijing, China), and all antibodies were used according to the manufacturer's instructions.
+ Open protocol
+ Expand
3

Western Blot Analysis of Bovine Granulosa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RIPA lysis buffer (Beyotime, Shanghai, China) containing proteinase inhibitors was used to lyse bovine GCs from each group. The extracted protein content was determined using a BCA Protein Assay Kit (Beyotime). Samples containing 50 μg were separated on sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE, 12% acrylamide gel containing 0.1% SDS), and transferred onto a polyvinylidene difluoride (PVDF) membrane (BioTraceNT, Pall Corp., Port Washington, NY, USA). Membranes were then blocked for 1 h at 37 °C with 5% (w/v) skim milk in Tris-buffered saline (TBS) with 0.1% Tween 20 (TBST). Primary antibodies against SOD1 (CST 2770S), BAX (CST2772S), Caspase-3 (CST 9662S), PCNA (CST 81628S), CyclinB1 (CST 60691S), STAR (ab237908), Cyp11A1 (ab175408), HSP70 (CST 4872S), and β-actin (CST 4967S) were incubated overnight at 4 °C on the membranes (Cell Signaling Technology, Beverly, MA, Abcam, USA). The membranes were then washed three times with TBST and incubated at room temperature for one hr with HRP-conjugated secondary antibody (Zhongshan Biotechnology, Beijing, China). Finally, the protein bands were visualized using enhanced chemiluminescence (ECL) detection kit (Tanon, Shanghai, China). Proteins were quantified by densitometry using Image J 1.44p software, and β-actin was used as loading controls for normalization.
+ Open protocol
+ Expand
4

Western Blot Analysis of PTPN14, ZEB1, and E-cadherin

Check if the same lab product or an alternative is used in the 5 most similar protocols
SDS-PAGE gels (8–12%) were prepared to perform the Western blot assays. The proteins in gels were transferred on PVDF membranes using 200 mA for 90 min, followed by the PVDF membranes were blocked by 3% BSA. The proteins of PTPN14, ZEB1 and E-cadherin were detected with anti-PTPN14 mouse monoclonal antibody, anti-ZEB1 mouse monoclonal antibody and anti-E-cadherin rabbit antibody. GAPDH proteins served as an internal control. All antibodies were purchased from Cell Signaling Technology. The membranes were next incubated with HRP-conjugated secondary antibody (Zhongshan Biotechnology, China). The proteins were detected using SuperSignal® West Dura Extended Duration Substrate kit (Thermo).
+ Open protocol
+ Expand
5

Western Blot Analysis of Bovine Granulosa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bovine GCs from each group were lysed with RIPA lysis buffer (Beyotime, Shanghai, China) having proteinase inhibitors. BCA Protein Assay Kit (Beyotime) was used for the determination of the extracted protein concentration. Equal amounts of protein (10 μg) were subjected to 10% SDS-polyacrylamide gel electrophoresis, and transferred onto a polyvinylidene difluoride (PVDF) membrane for 60 min. For blocking the membrane, skim milk in Tris-buffered saline (20 mM Tris-HCl, pH 7.6, 137 mM NaCl) with 0.1% Tween-20 (TBST) was used for 60 min at 38 °C and incubated with primary antibodies: anti CAT, BAX, Caspase-3, PCNA, CyclinB1, STAR, Cyp11A1, and β-actin (Cell Signaling Technology, Beverly, MA, USA), at 4 °C overnight. After washing with TBST thrice, membranes were incubated with HRP-conjugated secondary antibody (Zhongshan Biotechnology, Beijing, China) for 1 h at room temperature. The bands of protein were visualized through a chemiluminescence detection kit (Tanon, Shanghai, China). The bands were measured using the Image J 1.44p software and β-actin was used as a reference protein for normalization.
+ Open protocol
+ Expand
6

Immunohistochemical analysis of ACOX1 in ICP

Check if the same lab product or an alternative is used in the 5 most similar protocols
Formalin-fixed tissues from both ICP and control groups were embedded in paraffin, sectioned at 5 μm, and mounted on silane-coated slides. Sections were de-waxed and rehydrated by descending grades of alcohol and finally distilled water; endogenous peroxidase was blocked using 3% (v/v) hydrogen peroxidase in phosphate buffered saline (PBS). The sections were subjected to microwave antigen retrieval in 0.02 M EDTA, washed in PBS, and blocked with goat serum (Beijing ZhongShan Biotechnology) for 2 h. Sections were subsequently incubated overnight at 4°C with anti-ACOX1 (1:250). Sections were incubated with HRP-conjugated secondary antibody (1:1,000; Beijing ZhongShan Biotechnology) for 1 h at room temperature after being washed three times in PBS. Immunoreactivity was demonstrated using diaminobenzidine (Beijing ZhongShan Biotechnology) for increased sensitivity, which produced a brown insoluble precipitate at immunopositive sites. Sections were counterstained with hematoxylin and mounted with a cover glass. Negative controls were incubated with a solution devoid of primary antibodies. All immunostained sections were evaluated in a blinded manner by two observers. At the same time, Image J software was used to determine the intensity of staining in various parts of the placental sections from ICP and control groups.
+ Open protocol
+ Expand
7

Western Blot Protocol for Protein Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells or tissues were lysed using RIPA lysis buffer containing protease inhibitor cocktail (Sigma). The protein concentration was determined using the bicinchonic acid protein assay kit (Applygen Technologies Inc., Beijing, China). The proteins (20 μg/lane) were separated on 10% SDS-PAGE gel and electrotransferred onto PVDF membranes (Millipore, Bedford, MA, USA). The membranes were blocked on Tris-buffered saline (pH 7.4) containing 5% non-fat milk at room temperature for 1 h and incubated with the primary antibodies overnight at 4 °C. The membranes were washed twice with appropriate HRP-conjugated secondary antibodies (Zhongshan Biotechnology Co.) at room temperature for 1 h. Antigen/antibody complexes were visualized using an enhanced chemiluminescence detection kit (Zhongshan Biotechnology Co.).
+ Open protocol
+ Expand
8

Immunohistochemical Analysis of SOX9 and Peli2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunohistochemical analyses were carried out as previously described [20 (link)]. The primary and secondary antibodies used in this study were SOX9, Peli2, and HRP-conjugated secondary antibodies (Zhongshan Biotechnology, Beijing, China). For each section, ten images were randomly captured at 200× magnification under a light microscope. The total cells and the SOX9- or Peli2-positive cells in each image were counted automatically using ImageJ software. After calculating the average of ten images, excluding the minimum and maximum values, the positive ratio of SOX9- or Peli2-expressing cells was determined; six sections per group of mice were taken for statistical analysis.
+ Open protocol
+ Expand
9

Molecular Mechanisms of Salinomycin and Doxorubicin-Induced Apoptosis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Salinomycin, doxorubicin and PKF 118-310 were purchased from Sigma-Aldrich (St. Louis, MO, USA). Total-FOXO3a (t-FOXO3a), phospho-FOXO3a (Thr32; p-FOXO3a), total-AKT (t-AKT), phospho-AKT (Ser473; p-AKT), E-cadherin, Vimentin, β-catenin and TCF4 primary antibodies for western blotting, immunoprecipitation or immunofluorescence were obtained from Cell Signaling (Danvers, MA, USA). GAPDH primary antibodies were obtained from Kangchen Biotechnology (Sichuan, China). The HRP-conjugated secondary antibodies, goat-anti-mouse second antibody and goat-anti-rabbit second antibody, were purchased from Beijing ZhongShan Biotechnology Company (Beijing, China). Propidium iodide (PI) and anti-rabbit Alexa Fluor 488 (AF488) secondary antibody were both purchased from Invitrogen (Carlsbad, CA, USA).
+ Open protocol
+ Expand
10

Western Blot Analysis of EGFR Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
After transfection for 48 hrs, the cells were first lysed with RIPA lysis buffer (Beyotime, Shanghai, China) containing a cocktail of protease inhibitors and phosphatase inhibitors for 30 min. on ice and were then centrifuged at 10,303 g for 20 min. The total protein concentration was measured by using a Bradford assay. Equal amounts of the protein samples were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and blotted onto a nitrocellulose membrane (Millipore, Bedford, MA, USA). The blot was blocked for 1 hr and then incubated overnight with a primary antibody against EGFR (Abcam, Cambridge, UK) and β-actin (Santa Cruz, CA, USA). After extensive rinsing, the blot was incubated with HRP-conjugated secondary antibodies (Zhongshan Biotechnology, Beijing, China) for 2 hrs at room temperature (RT). The immunoreactive bands were detected with an enhanced chemiluminescence reagent (Millipore, Billerica, MA, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!