Log In Sign up
The largest database of trusted experimental protocols

Qscript one step fast mgb qrt pcr kit

Manufactured by Quanta Biosciences
Visit Supplier

The QScript One-Step Fast MGB qRT-PCR kit is a reagent system for the detection and quantification of RNA targets through one-step reverse transcription and real-time PCR amplification. The kit utilizes a Taq DNA polymerase and a proprietary RNA reverse transcriptase for efficient cDNA synthesis and amplification.

Automatically generated - may contain errors

Lab products found in correlation

Cfx96 touch thermocycler, by Bio-Rad (2 mentions) Nuclisens easymag 2.0 instrument, by bioMérieux (1 mentions)

2 protocols using qscript one step fast mgb qrt pcr kit

1

Quantification of HIV-1 Genomic RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantification of HIV-1 genomic RNA was performed as previously described16 (link). Briefly, 100 µl aliquots of both the MNP-virus complexes eluted from magnetic column and the flow through fraction were subjected to nucleic acid extraction on NucliSENS Biomerieux EasyMag 2.0 instrument (BioMerieux, Durham, NC). One step real-time PCR was performed with qScript One-Step Fast MGB qRT-PCR kit (Quanta Biosciences, Gaithersburg, MD) using the following primer set: HIV-1 gag F1: GAGGCTAGAAGGAGAGAGATGGGT, HIV-1 gag R1: CCCTGGCCTTAACCGAATTT and the SR73 probe: VIC-GGG TGC GAG AGC GTC AGT ATTA-MGB. Amplifications were carried out on a BioRad CFX96 Touch Thermocycler (Hercules, CA) according to the following cycling parameters: 7:30 min at 48 °C, 30 sec at 95 °C followed by 45 cycles of 3 sec at 95 °C and 25 sec at 60 °C.
Arakelyan A., Fitzgerald W., Zicari S., Vanpouille C, & Margolis L. (2017). Extracellular Vesicles Carry HIV Env and Facilitate Hiv Infection of Human Lymphoid Tissue. Scientific Reports, 7, 1695.
+ Open protocol
+ Expand
2

DENV Detection in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
A 200 μl aliquot of the MNPs complexes with DENV produced in BHK-21 and LoVo cells and flow through fractions were subjected to nucleic acid extraction using a NucliSENS easyMAG 2.0 instrument (BioMérieux, Durham, NC). RT-PCR was performed with a qScript One-Step Fast MGB qRT-PCR kit (Quanta BioSciences, Gaithersburg, MD) using a one-step assay with the following primer set: DENV 2 NGC (forward): TATGCTGAAACGCGAGAGAAA, DENV 2 NGC (reverse): CTGCAGCATTCCAAGTGAGA, and the probe: FAM- CCG CGT GTC GAC TG TAC AAC AGC -MGB. Amplifications were carried out on a BioRad CFX96 Touch Thermocycler according to the following cycling parameters: 7.5 minutes at 48°C, 30 seconds at 95°C, followed by 45 cycles of 3 seconds at 95°C and 25 seconds at 60°C.
Zicari S., Arakelyan A., Fitzgerald W., Zaitseva E., Chernomordik L.V., Margolis L, & Grivel J.C. (2015). EVALUATION OF THE MATURATION OF INDIVIDUAL DENGUE VIRIONS WITH FLOW VIROMETRY. Virology, 488, 20-27.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!