Zr 96 dna sequencing clean up kit

Manufactured by Zymo Research

Sourced in United States

The ZR-96 DNA Sequencing Clean-up Kit is a laboratory tool designed to purify DNA samples prior to DNA sequencing. The kit utilizes a 96-well format to efficiently process multiple samples simultaneously.

Automatically generated - may contain errors

Lab products found in correlation

Abi 3500xl genetic analyzer, by Thermo Fisher Scientific (4 mentions) Onetaq quick load 2x master mix, by New England Biolabs (2 mentions) Zymoclean gel dna recovery kit, by Zymo Research (2 mentions) Dreamtaq dna polymerase, by Thermo Fisher Scientific (2 mentions) Bigdye terminator cycle sequencing ready reaction kit version 3, by Thermo Fisher Scientific (1 mentions) Qiaquick pcr purification kit, by Qiagen (1 mentions) Pcr purification kit, by Qiagen (1 mentions) Csl ag500, by Cleaver Scientific (1 mentions) Pop 7 polymer for 3500 3500xl genetic analyzers, by Thermo Fisher Scientific (1 mentions) Exosap it pcr product cleanup kit, by Thermo Fisher Scientific (1 mentions) Zr fungal bacterial kit, by Zymo Research (1 mentions) Quick dna fungal bacterial miniprep kit, by Zymo Research (1 mentions) Seqscape2, by Thermo Fisher Scientific (1 mentions) Qiaamp dna blood mini kit, by Qiagen (1 mentions) Zr fungal bacterial dna kit, by Zymo Research (1 mentions)

8 protocols using zr 96 dna sequencing clean up kit

Amplicon Purification and Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Column purification of amplicons was performed with QIAquick PCR purification kits (Qiagen, Hilden, Germany). BigDye terminator cycle sequencing ready reaction kit version 3.1 (Applied Biosystems, Carlsbad CA, USA) was used for Sanger sequencing utilising four primers; HIV+4141 (5' TCT ACC TGG CAT GGG TAC CA 3' nucleotide positions relative to HXB2 4141–4160), INFORI (5' GGA ATC ATT CAA GCA CAA CCA GA 3' nucleotide positions relative to HXB2 4059–4081), INREVII (5' CCT AGT GGG ATG TGT ACT TCT GA 3' nucleotide positions relative to HXB2 5197–5219 and IN4764AS (5' CCATTTGTACTGCTGTCTTAA 3’ nucleotide positions relative to HXB2 4764–4744).
The cycle sequencing reaction mix contained 3.8 μL of dH₂0, 3 μL of Big Dye 5X sequencing buffer, 1 μL Big Dye terminator, 0.2 μL of 10 μM of each sequencing primer and 2 μL of the purified DNA template to make a total reaction volume of 10 μL. Cycle sequencing parameters were the same as for those used for the VS-Int assay.
Purification of cycle sequencing products was done using ZR-96 DNA sequencing clean-up kit (Zymo research, Irvine, CA, USA) according to manufactures instructions.

Seatla K.K., Choga W.T., Mogwele M., Diphoko T., Maruapula D., Mupfumi L., Musonda R.M., Rowley C.F., Avalos A., Kasvosve I., Moyo S, & Gaseitsiwe S. (2019). Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples. PLoS ONE, 14(11), e0224292.

+ Open protocol

+ Expand

PCR Product Visualization and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products were visualized in 1.4% agarose gel(CSL-AG500, Cleaver Scientific Ltd., Rugby, UK) stained with EZ-vision^®Bluelight DNA Dye (Bio-Rad Laboratories, Irvine, CA, USA). A100bp DNA ladder was used asa standard marker. PCR products were then purified using Qiagen PCR Purification Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocol. Fragments were sequenced at Inqaba South Africa using the same forward and reverse primers as used to generate the PCR products. The labeled products were then cleaned with the ZR-96 DNA Sequencing Clean-up Kit (Zymoresearch, Irvine, CA, USA) (http://www.zymoresearch (accessed on 18 November 2019)). The cleaned products were injected on the Applied Biosystems ABI 3500XL Genetic Analyzer with a 50cm array using POP7 (Applied Biosystem, Foster city, CA, USA) (https://www.thermofisher.com (accessed on 18 November 2019)). Sequence chromatogram analysis was performed using Finch TV analysis software (Applied Biosystem, Foster city, CA, USA) (https://www.softpedia.com/get/Science-CAD/FinchTV.shtml (accessed on 18 November 2019)).

Damian D., Damas M., Wensman J.J, & Berg M. (2021). Molecular Diversity of Hard Tick Species from Selected Areas of a Wildlife-Livestock Interface Ecosystem at Mikumi National Park, Morogoro Region, Tanzania. Veterinary Sciences, 8(3), 36.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 16S rRNA genes of the bacterial isolates with ligninolytic activities were analyzed. The 16S rDNA was amplified, and sequence analyzed through BLAST (NCBI). The bacteria genomic DNA was extracted from the colonies using Quick-DNA™ Fugal/Bacterial Miniprep Kit (Zymo Research, USA). The targeted region of 16S rDNA was tagged with OneTaq ® Quick-Load® 2X Master Mix (New England Biolabs® Inc., USA) along with 16S–1492R (5’-CGGTTACCTTGTTAC-GACTT-3’) and 16S-27F (5’-AGAGTTTGATCMTG-GCTCAG-3’) primers, respectively. The products were then run through a gel and extracted with Zymoclean™ Gel DNA Recovery Kit (Zymo Research, USA). The DNA fragments extracted were further sequenced with Nimagen (The Netherlands), BrilliantDye™ Terminator v3.1 Cycle Sequencing Kit (BRD3-1000) and purified with Zymo Research (USA), ZR-96 DNA Sequencing Clean-up Kit™. The pure fragments were analyzed using the ABI 3500xL Genetic Analyzer (Applied Biosystems™, ThermoFisher Scientific Inc., USA). The file generated by the ABI analyzer was further analyzed with GLC Bio Main Workbench v7.6 with the aid of BLAST search (NCBI). The phylogenetic tree was constructed by neighbor joining methods, and 99% similarity with existing isolates in the database was considered (Xiong et al. 2020 (link)).

Dube S.L., Osunsanmi F.O., Ngcobo B.P., Mkhwanazi L.B., Jobe Z.Z., Aruleba R.T., Mosa R.A, & Opoku A.R. (2023). Isolation and Characterization of Potential Lignin Peroxidase-Producing Bacteria from Compost Samples at Richards Bay (South Africa). Polish Journal of Microbiology, 72(2), 117-124.

+ Open protocol

+ Expand

Trypanozoon sp. Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products from the Trypanozoon sp.-positive sample, all the T. congolense-positive samples and 20 randomly selected T. vivax samples were sequenced in both directions by a commercial company. According to the protocol provided, PCR products were cleaned up with an ExoSAP-IT™ PCR Product Cleanup kit (Applied Biosystems™, Thermo Fisher Scientific) and sequenced using the BrilliantDye™ Terminator Cycle Sequencing Kit V3.1 (NimaGen B.V., Nijmegen, The Netherlands), following the manufacturers’ instructions. The labeled products were cleaned with the ZR-96 DNA Sequencing Clean-up Kit (Zymo Research, Irvine, CA, USA) and injected on to the Applied Biosystems ABI 3500XL Genetic Analyzer with a 50-cm array, using POP-7™ Polymer for 3500/3500xL Genetic Analyzers (Applied Biosystems™).
Sequence chromatogram analysis, manual clean-up, assembly and generation of census sequences were performed using the Bio Edit Sequence Alignment Editor version 7.2.5 [20 ]. The basic local alignment search tool (BLAST) [21 ] was used to identify homologous sequences in GenBank to those obtained in this study.

Kizza D., Ocaido M., Mugisha A., Azuba R., Nalule S., Onyuth H., Musinguzi S.P., Okwasiimire R, & Waiswa C. (2021). Prevalence and risk factors for trypanosome infection in cattle from communities surrounding the Murchison Falls National Park, Uganda. Parasites & Vectors, 14, 513.

+ Open protocol

+ Expand

Bacterial Endophyte 16S rRNA Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction was done using a ZR Fungal/Bacterial Kit™ (Zymo Research, catalog no. R2014) according to the manufacturer's instructions. Polymerase chain reaction (PCR) was done to amplify the 16S rRNA gene of each bacterial endophyte with the primers 16S‐27F: 5′‐AGAGTTTGATCMTGGCTCAG‐3′ and 16S‐1492R: 5′‐CGGTTACCTTGTTACGACTT‐3′, using DreamTaq™ DNA polymerase (Thermo Scientific™). PCR products were gel extracted (Zymo Research, Zymoclean™ Gel DNA Recovery Kit), and sequenced in the forward and reverse directions on the ABI PRISM™ 3500xl Genetic Analyser. The sequencing was performed at Inqaba Biotechnical Industries (Pty) Ltd. The PCR products were cleaned with ExoSAP‐it™ following the manufacturer's recommendations. Purified sequencing products (Zymo Research, ZR‐96 DNA Sequencing Clean‐up Kit™) were analyzed using CLC Main Workbench 7, followed by a BLAST search (NCBI) (Kuklinsky‐Sobral, Arajo, Mendes, Pizzirani‐Kleiner, & Azevedo, 2005).

Sebola T.E., Uche‐Okereafor N.C., Tapfuma K.I., Mekuto L., Green E, & Mavumengwana V. (2019). Evaluating antibacterial and anticancer activity of crude extracts of bacterial endophytes from Crinum macowanii Baker bulbs. MicrobiologyOpen, 8(12), e914.

+ Open protocol

+ Expand

Cyanobacteria Identification via 16S rRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

16S rRNA identification was performed for the characterisation of the isolated cyanobacteria with some modifications. Genomic DNA was extracted from the cultures received using the Quick-DNA™ Fungal/Bacterial Miniprep Kit (Zymo Research, Irvine, CA, USA, Catalogue No. D6005). The 16S target region was amplified using OneTaq^® Quick-Load^® 2X Master Mix (New England Biolabs (Ipswich, MA, USA), Catalogue No. M0486) with the cyano-primers CYA359F (5′GGGGAATCTTCCGCAATGGG-3′), CYA781R (a&b), CYA781Ra (5′-GACTACT GGGGTATCTAATCCCATT-3′), and CYA781Rb (5′-GACTACAGGGGTATCTAATCCCTTT-3′). The PCR products were run on a gel and gel-extracted with a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Catalogue No. D4001). The extracted fragments were sequenced in the forward and reverse direction (Nimagen, (Nijmegen, The Netherlands) BrilliantDye™ Terminator Cycle Sequencing Kit V3.1, BRD 3-100/1000) and purified (Zymo Research, ZR-96 DNA Sequencing Clean-up Kit™, Catalogue No. D4050). The purified fragments were analysed on an ABI 3500 XL Genetic Analyzer (Applied Biosystems, ThermoFisher Scientific, Waltham, MA, USA). A CLC Bio Main Workbench v 7.6 (Qiagen, Hilden, Germany) was used to analyse the .ab1 files generated by the ABI 3500 XL/ABI 3730 XL Genetic Analyzer, and results were obtained by a BLAST search (NCBI) [22 (link)].

Ikhane A.O., Sithole S.Z., Cele N.D., Osunsanmi F.O., Mosa R.A, & Opoku A.R. (2024). In Vitro Antioxidant and In Silico Evaluation of the Anti-β-Lactamase Potential of the Extracts of Cylindrospermum alatosporum NR125682 and Loriellopsis cavenicola NR117881. Antioxidants, 13(5), 608.

+ Open protocol

+ Expand

Sanger Sequencing of GLA Gene

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

In terms of genotype analysis, GLA gene sequence analysis was performed. The seven exons of the GLA gene were amplified by polymerase chain reaction (PCR) with specific primers and sequenced by the Sanger method on a genetic analyzer (Applied Biosystems Inc. CA, USA). Results were analyzed using the software SeqScape 2.5.0 (Applied Biosystems Inc. CA, USA). DNA was extracted with an QIAamp DNA Blood Mini Kit (Qiagen Inc.). A total of 7 pairs of PCR primers were designed to amplify the 7 exons encoding the GLA gene (29 (link)). The PCR amplifications were carried out using Taq DNA polymerase (PhireII HS, Thermo Inc.) and a PCR protocol was set, having an initial hold of 1 minute at 95°C, 45 cycles (of 10 seconds at 95°C, 10 seconds at 60°C and 20 seconds at 72°C), and a final extension of 1 minute at 72°C. After the thermal cycle protocol for PCR, the product was checked using 2% agarose gel electrophoresis. PCR products were purified using the ZR-96 DNA Sequencing Clean-up Kit (Zymo Research Corp.) and the purified products were sequenced bidirectionally on a ABI 3130 capillary gel electrophoresis system (Applied Biosystems Inc. CA, USA) according to the manufacturer’s protocol. The exons of the gene and the exon-intron connections were analyzed by the SeqScape 2.5.0 (Applied Biosystems Inc. CA, USA) software and the sequence variations were determined.

Barman H.A., Özcan S., Atıcı A., Özgökçe C., Öztürk A., Kafalı A.E., Çakar N.E., Tavşanlı M.E., Küçük M., Şahin İ, & Okuyan E. (2020). Ratio of Fabry disease in patients with idiopathic left ventricular hypertrophy: A single-center study in Turkey. Anatolian Journal of Cardiology, 23(2), 79-85.

+ Open protocol

+ Expand

16S rRNA-based Bacterial Identification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Axenic bacterial cultures which had emerged best laccase producers had their genomic DNA extracted using the ZR Fungal/Bacterial DNA kit^™ (Zymo Research). Their 16S target region was amplified using Dream Taq DNA polymerase (Thermo Scientific^™) and the universal primers, 27F: 5′-AGAGTTTGATCMTGGCTCAG-3′ and 1429R: 5′-CGGTTACCTTGTTACGATT-3′. Amplicons obtained from PCR run were gel extracted (Zymo Research, Zymoclean^™ Gel DNA Rocover Kit), and sequenced in the forward and reverse directions on the ABI PRISM^™ 3500xl Genetic Analyzer. Purified sequencing products (Zymo Research, ZR-96 DNA sequencing clean-up kit^™) were analyzed using CLC Main Workbench 7 followed by a BLAST search (NCBI database) for most probable strain identification. Thereafter, sequences were submitted to Genbank for accession numbers, while the Molecular Evolutionary Genetics Analysis software (MEGA 7) was used to elucidate the phylogenetic relationships between isolates per aquatic milieu, with reference to isolates in the NCBI library.

Unuofin J.O., Okoh A.I, & Nwodo U.U. (2019). Recovery of laccase-producing gammaproteobacteria from wastewater. Biotechnology Reports, 21, e00320.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!