293t cell line

Manufactured by National Collection of Authenticated Cell Cultures

Sourced in China

The 293T cell line is a widely used human embryonic kidney cell line that has been engineered to stably express the large T antigen of the SV40 virus. This cell line is commonly used for the production and study of recombinant proteins, viral vectors, and other biological products.

Automatically generated - may contain errors

Lab products found in correlation

17 protocols using 293t cell line

Autophagy Regulation in Mammary Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HC11 murine mammary gland epithelial cell line and 293T cell line were purchased from National Collection of Authenticated Cell Cultures (Shanghai, China). HC11 was grown at 5% CO₂ in 1640 (Gibco, Cheshire, CT, USA), with 10% fetal bovine serum (FBS, Gibco, Cheshire, CT, USA), 1% sodium pyruvate (Gibco, Cheshire, CT, USA), and 1% glutamine (Gibco, Cheshire, CT, USA) at 37 °C. The 293T cell line was grown at 5% CO₂ in DMEM (Gibco, Cheshire, CT, USA), with 10% FBS (Gibco, Cheshire, CT, USA), 1% sodium pyruvate (Gibco, Cheshire, CT, USA), and 1% glutamine (Gibco, Cheshire, CT, USA) at 37 °C. HC11 cells were transfected with miR-30a-3p inhibitor (5′-3′: CUUUCAGUCGGAUGUUUGCAGC, Genepharma, Shanghai, China), Atg12 siRNA, Atg5 siRNA, negative control (Genepharma, Shanghai, China), pEGFP-C1, pEGFP-miR-30a-3p, pCMV6-Atg12, and control plasmids using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s protocol. Baf A1 (50 nM; CAS 88899-55-2, InvivoGEN, San Diego, CA, USA) and rapamycin (100 nM, V900930, Sigma-Aldrich, St. Louis, MO, USA) were applied.

Tian L., Guo S., Zhao Z., Chen Y., Wang C., Li Q, & Li Y. (2023). miR-30a-3p Regulates Autophagy in the Involution of Mice Mammary Glands. International Journal of Molecular Sciences, 24(18), 14352.

+ Open protocol

+ Expand

Esophageal Squamous Cell Carcinoma Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

ESCC cell lines including KYSE150, TE-1 (National Collection of Authenticated Cell Cultures, ShangHai, China), KYSE510, TE-7 (Guangzhou Jennio Biotech Co. Ltd., Guangzhou, China), and EC109 (National Infrastructure of Cell Line Resource, Beijing, China). Immortalized human esophageal squamous epithelial cell line Het-1A was purchased from ATCC (American Type Culture Collection, Manassas, VA, USA; Cat# CRL-2692^TM). 293T cell line was purchased from (National Collection of Authenticated Cell Cultures). ESCC and 293T cell lines were cultured in RPMI-1640 and DMEM medium (HyClone™, USA), respectively, supplemented with 10% fetal bovine serum (FBS; Gibco^TM, Thermo Scientific™, USA; Cat# 10099141C), 100 μg/ml streptomycin, and 100 units/ml penicillin (HyClone™). Het-1A cells were grown in BEGM™ Growth Medium (Lonza Walkersville Inc., USA). All cell lines were authenticated by STR and tested for mycoplasma recently.

Shi Y., Xiang Z., Yang H., Khan S., Li R., Zhou S., Ullah S., Zhang J, & Liu B. (2021). Pharmacological targeting of TNS3 with histone deacetylase inhibitor as a therapeutic strategy in esophageal squamous cell carcinoma. Aging (Albany NY), 13(11), 15336-15352.

+ Open protocol

+ Expand

Chondrosarcoma and Chondrocyte Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human chondrosarcoma cell lines SW1353 and Hs819.T were purchased from American Type Culture Collection (Manassas, VA, USA) and the mouse chondrogenic cell line ATDC5 was purchased from RIKEN Cell Bank (Tsukuba, Japan). The 293T cell line was purchased from the China Center for Type Culture Collection (Wuhan, China). SW1353 and ATDC5 were cultured in Dulbecco’s modified Eagle medium (DMEM)/F-12 medium (HyClone, Logan City, UT, USA) supplemented with 10% fetal bovine serum (FBS) (HyClone). Hs819.T and 293 T cells were cultured in DMEM medium (HyClone) supplemented with 10% FBS.
Mouse primary chondrocytes were isolated from the articular cartilage of 12-week-old C57BL/6 mice. Human ACs were obtained from ScienCell (Carlsbad, CA, USA). Both mouse and human chondrocytes were cultured in DMEM/F-12 supplemented with 10% FBS.

Lian C., Wang X., Qiu X., Wu Z., Gao B., Liu L., Liang G., Zhou H., Yang X., Peng Y., Liang A., Xu C., Huang D, & Su P. (2019). Collagen type II suppresses articular chondrocyte hypertrophy and osteoarthritis progression by promoting integrin β1−SMAD1 interaction. Bone Research, 7, 8.

+ Open protocol

+ Expand

Cell Culture of Human Cancer Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human cervical cancer cell lines, HeLa and C33A, and the 293T cell line were obtained from the China Center for Type Culture Collection. All cells were cultured in DMEM (HyClone; Cytiva), supplemented with 10% heat-inactivated FBS (Invitrogen; Thermo Fisher Scientific, Inc.), 100 IU/ml penicillin and 100 µg/ml streptomycin, and placed at 37°C in a humidified incubator containing 5% CO₂.

Yang Q., Zhao Y., Chen Y., Chang Y., Huang A., Xu T., Li G, & Wu G. (2020). PAK6 promotes cervical cancer progression through activation of the Wnt/β-catenin signaling pathway. Oncology Letters, 20(3), 2387-2395.

+ Open protocol

+ Expand

Osteosarcoma Cell Lines for Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

Osteosarcoma cell lines that included SaoS-2, U-2OS, HOS, MG-63, human normal osteoblasts hFOB1.19 cell line and human renal epithelial 293T cell line were obtained from China Center for Type Culture Collection (CCTCC, Shanghai, China). Cells were grown in Dulbecco's modified Eagle's medium, Eagle's minimal essential medium, DMEM-F12 growth medium, and McCoy's 5A medium mixed with 10.0% fetal bovine serum (FBS) that were purchased from Gibco (Gibco, USA). The cells were incubated overnight at 37°C in a 5% CO2 humidified environment. The cells were trypsinized when they reached 75% confluence and were then used for in vitro and in vivo studies.

Yu W., Tang L., Lin F., Yao Y, & Shen Z. (2019). DGKZ Acts as a Potential Oncogene in Osteosarcoma Proliferation Through Its Possible Interaction With ERK1/2 and MYC Pathway. Frontiers in Oncology, 8, 655.

+ Open protocol

+ Expand

Cell Culture of HCT116 and 293T

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human colon cancer cell line (HCT116) and 293T cell line were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences, and the cells were grown in McCoy's 5A medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Wisent, Inc.) and 1% penicillin/streptomycin (Wisent, Inc.). The cells were cultured at 37°C with 5% CO₂. Mycoplasma testing was performed for the cell lines used.

Guo J., Zhu S., Deng H, & Xu R. (2021). HSP60-knockdown suppresses proliferation in colorectal cancer cells via activating the adenine/AMPK/mTOR signaling pathway. Oncology Letters, 22(2), 630.

+ Open protocol

+ Expand

Cell Culture of Human Adherent Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human LEC line HLE-B3 was purchased from the American Type Culture Collection and the 293T cell line was obtained from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. Both cells were cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.), supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), and maintained in a humidified atmosphere at 37°C and 5% CO₂.

Zhao L., Wang J., Zhang Y., Wang L., Yu M, & Wang F. (2020). Vitamin C decreases VEGF expression levels via hypoxia-inducible factor-1α dependent and independent pathways in lens epithelial cells. Molecular Medicine Reports, 22(1), 436-444.

+ Open protocol

+ Expand

SH-SY5Y and 293T Cell Culture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The SH-SY5Y cell line was obtained from the American Type Culture Collection (cat. no. CRL-2266) and the 293T cell line was obtained from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. Cells were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% FBS and 1% penicillin-streptomycin solution (all from Biological Industries) and placed in a humidified incubator with 5% CO₂ at 37°C. Cell culture dishes were obtained from Hangzhou Xinyou Biotechnology Co., Ltd.

Ye M., Xie L., Zhang J., Liu B., Liu X., He J., Ma D, & Dong K. (2020). Determination of long non-coding RNAs associated with EZH2 in neuroblastoma by RIP-seq, RNA-seq and ChIP-seq. Oncology Letters, 20(4), 1.

+ Open protocol

+ Expand

Transfecting 293T Cells with GFAP Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

All plasmids were purchased from GeneCreate. cDNA of wild-type (WT) or mutant (MUT) GFAP (NM_002055.5) was inserted into the pcDNA3.1-green fluorescent protein (GFP) plasmids to express GFP-tagged fusion proteins. The 293T cell line was obtained from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences. 293T cells were grown in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C in a humidified incubator with 5% CO₂. Next, 2×10⁵ cells/well were seeded into 6-well plates or 5×10⁴ cells/well were seeded into 24-well plates for transfection. Then, 24 h after plating, 293T cells were transiently transfected with WT or MUT GFAP-GFP (c.214G>A and c.1235C>T) plasmids using Lipofectamine^® 3000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.) at room temperature. A hot-spot mutation (c.715C>T, p.R239C) was set as the positive control (8 (link)). All experiments were independently repeated three times.

Song X., Jiang J., Tian W., Zhan F., Zhu Z., Li B., Tang H, & Cao L. (2021). A report of two cases of bulbospinal form Alexander disease and preliminary exploration of the disease. Molecular Medicine Reports, 24(2), 572.

+ Open protocol

+ Expand

Cell Culture Conditions for Lung Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human normal lung epithelial cells BEAS-2, and human LSCC cell lines NCI-H226 and NCI-H520 were obtained from Procell (Wuhan, Hubei, CHN). BEAS-2 cells were grown in BEAS-2B cell specific medium (Procell, CHN). H226 and H520 cells were grown in Roswell Park Memorial Institute (RPMI) 1640 with 10% calf bovine serum and 1% penicillin-streptomycin at 37°C with 5% CO₂ (v/v). A 293T cell line (Type Culture Collection of the Chinese Academy of Sciences, Shanghai, CHN) was grown in Dulbecco’s modified Eagle’s medium (DMEM) with calf bovine serum (10%) and penicillin-streptomycin (1%) at 37°C with 5% CO₂ (v/v). Medium was replaced 2 to 3 days and the cells were passaged when the cell adherence area reached 80% of the culture dish.

Wang W., Liu Y, & Zhao L. (2020). Tambulin Targets Histone Deacetylase 1 Inhibiting Cell Growth and Inducing Apoptosis in Human Lung Squamous Cell Carcinoma. Frontiers in Pharmacology, 11, 1188.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!