Oligreen reagent

mRNA content of PGC‐1α was measured using Real‐time PCR on a ABI‐7900 Sequence Detection System (Applied Biosystems, Forster City, CA). Primers and 5'‐6‐carboxyfluorescein (FAM) / 3'‐6‐carboxy‐N,N,N',N'‐tetramethylrhodamine (TAMRA) labeled Taqman probe were designed using Primer express 3.0 software (Applied Biosystems) and PGC‐1α forward primer (5' AGCCAAACCAACAACTTTATCTCTTC 3'), reverse primer (5' TTAAGGTTCGCTCAATAGTCTTGTTC 3') and Taqman probe (5' AGAGTCACCAAATGACCCCAAGGGTTCC 3') were obtained from TAG Copenhagen (Copenhagen, Denmark). Real‐time PCR was run in triplicates in a total reaction volume of 10 μL using Universal Mastermix (Applied Biosystems). A standard curve, constructed from a dilution of a pooled portion of the cDNA samples, was run with the samples, and used to convert the cycle thresholds to a relative amount. The PGC‐1α mRNA content of each sample was normalized to total single stranded (ss) DNA content in the sample, determined with OliGreen reagent (Molecular Probes, Leiden, The Netherlands) as previously described (Lundby et al. 2005).

Real‐time PCR was performed using ABI‐7900 Sequence Detection System (Applied Biosystems, Forster City, CA) to determine mRNA content of selected genes. Primers and 5’‐6‐carboxyfluorescein (FAM)/3’‐6‐carboxy – N,N,N’,N’‐tetramethylrhodamine (TAMRA)‐labeled Taqman probes (Table 2) were designed using Primer Express 3.0 software (Applied Biosystems) and obtained from TAG Copenhagen (Copenhagen, Denmark). Real‐time PCR was run in triplicates with a reaction volume of 10 μL using Universal Mastermix (Applied Biosystems). The cycle threshold for each sample was converted into an arbitrary amount of target mRNA, using a standard curve generated from a serial dilution of a pooled sample. Total single‐stranded (ss) DNA in each sample was determined, using OliGreen reagent (Molecular Probes, Leiden, The Netherlands) and used to normalize target gene mRNA content as previously described (Lundby et al. 2005).