Mgapdh

Manufactured by Thermo Fisher Scientific

Sourced in United States

MGapdh is a lab equipment product designed for the measurement of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) activity in biological samples. GAPDH is a key enzyme involved in the glycolytic pathway and is commonly used as a reference gene or loading control in various molecular biology and biochemical analyses.

Automatically generated - may contain errors

Lab products found in correlation

8 protocols using mgapdh

Quantitative PCR Analysis of Immune Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real‐time quantitative (Q‐)PCR analysis was carried out as described using the following oligos: ifnb1 (Mm00439546_s1; Applied Biosystems, Waltham, MA), mDdx58 (rig‐i, Mm00554529_m1 (Applied Biosystems), mDdx60 (Mm_Ddx60_2_SG QuantiTect Primer Assay,Qiagen, QT01074248), mGapdh (4352932E, Applied Biosystems), hGAPDH (402869, Applied Biosystems), hDDX60 (fwd‐TCCCAAAGCTGATAAAGAAGCCC and rev‐CATGTATTAGGCTTTGATCCACATTTCTG), hDDX60L (fwd‐CCAGGAATAAAGACTCAACTTTGG and rev‐CCTCTTCTTCCAGCACGACC), and lacZ fwd‐ATGGAAGATCCCGTCGTTTTACAACG and rev‐CAACTGTTGGGAAGGGCGAT.

Goubau D., van der Veen A.G., Chakravarty P., Lin R., Rogers N., Rehwinkel J., Deddouche S., Rosewell I., Hiscott J, & Reis e Sousa C. (2015). Mouse superkiller‐2‐like helicase DDX60 is dispensable for type I IFN induction and immunity to multiple viruses. European Journal of Immunology, 45(12), 3386-3403.

+ Open protocol

+ Expand

Quantitative Expression Analysis of GPR Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared with the Quick-RNA MiniPrep (Zymo research, R1055). Reverse transcription was performed with the SuperScript VILO cDNA Synthesis Kit (Invitrogen, 11754050). Quantitative PCR was performed with Taqman Master Mix (Life Technologies, 4324018). Probes included mGapdh (Applied Biosystems, Cat 4331182, Assay ID Mm99999915_g1), mGpr4 (Applied Biosystems, Cat 4448892, Assay ID Mm00558777_s1), mGpr65 (Applied Biosystems, Cat 4331182, Assay ID Mm02619732_s1), mGpr132 (Applied Biosystems, Cat 4331182, Assay ID Mm02620285_s1).

He X., Hawkins C., Lawley L., Freeman K., Phan T.M., Zhang J., Xu Y, & Fang J. (2020). Whole body deletion of Gpr68 does not change hematopoietic stem cell function. Stem cell research, 47, 101869.

+ Open protocol

+ Expand

Gene Expression Profiling in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RNA was extracted using an RNeasy Plus Kit (Qiagen, Germantown, MD, USA), and converted to cDNA using a High Capacity cDNA RT Kit (Applied Biosystems, Foster City, CA, USA). Each qPCR reaction used Taqman Fast 2x PCR Mix (Applied Biosystems) along with mGapdh (Mm99999915_g1), mPrkd1 (Mm00435790_m1), mCyba (p22^phox; Mm00514478_m1), mPdx1 (Mm00435565_m1), mKrt19 (Mm00492980_m1), mHes1, (Mm01342805_m1) or mMuc1 (Mm00449604_m1) primer/probe sets (Applied Biosystems). The reactions were run on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). All the C_T values were normalized to Gapdh and the ΔΔC_T method was used to calculate the fold changes.

Döppler H.R., Liou G.Y, & Storz P. (2022). Generation of Hydrogen Peroxide and Downstream Protein Kinase D1 Signaling Is a Common Feature of Inducers of Pancreatic Acinar-to-Ductal Metaplasia. Antioxidants, 11(1), 137.

+ Open protocol

+ Expand

Quantitative Fluorescent Immunoblotting of DNA Repair Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunoblotting was performed as described (Yang et al. 2020 (link)). The following antibodies were used: mTRF1 (#1449), mTRF2 (#1254), mXPB (Bethyl Laboratories A301-337A), mXPD (CST 11963), mZRANB3 (Abclonal A9555), mPOLD3 (Proteintech 21935-1-AP), mMNAT1 (Proteintech 11719-1-AP), mCDK7 (Proteintech 27027-1-AP), mCCNH (Proteintech 67065-1-Ig), mXPA (Proteintech 16462-1-AP), mCHK1 (Santa Cruz Biotechnology sc-8408), phospho-mCHK1 S345 (CST 2348), mGAPDH (Thermo Fisher MA5-15738), and γ-Tubulin (Sigma-Aldrich GTU88).
For quantitative fluorescent immunoblotting, membranes were blocked with Intercept TBS blocking buffer (Li-Cor 927-60001) for 1 h and then incubated with primary antibodies for 2 h. After three TBST washes, membranes were incubated with fluorescently labeled secondary antibodies IRDye 800CW goat antirabbit (Li-Cor 925-32211) and IRDye 680RD goat antimouse (Li-Cor 925-68070) for 1 h, followed by three TBST washes. Imaging was performed with a GE Typhoon system and quantified using ImageJ (1.51j8).

Yang Z., Sharma K, & de Lange T. (2022). TRF1 uses a noncanonical function of TFIIH to promote telomere replication. Genes & Development, 36(17-18), 956-969.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Inflammasome Genes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with a RNeasy Plus Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions, quantified with a spectrophotometer (NanoDrop ND-1000; Thermo Fisher Scientific, Waltham, MA), and stored at −80°C before use. RT-qPCR was performed as previously described [30 , 31 (link)]. In brief, the first strand cDNA was synthesized by RT from 1.0μg of total RNA using Ready-To-Go You-Prime First-Strand Beads (GE Healthcare, Piscataway, NJ), and qPCR was performed in a Mx3005P QPCR System (Stratagene, La Jolla, CA) with 20 μl reaction volume containing 5μl of cDNA, 1μl gene expression assay and 10μl TaqMan gene expression master mix. TaqMan gene expression assays (Thermo Fisher Scientific) used for this study were: mGAPDH (Mm99999915_g1), mNLRP3 (Mm00840904_m1), mNLRP6 (Mm00460229_m1), mASC (Mm00445747_ml), mCaspase-1 (Mm00438023_ml), hGAPDH (Hs02758991_g1), hNLRP3 (Hs00918082_m1), hNLRP6 (Hs00373246_m1), hPYCARD (Hs01547324_ml). The thermocycler parameters were 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. A non-template control was included to evaluate DNA contamination. The results were analyzed by the comparative threshold cycle (Ct) method and normalized by GAPDH as an internal control.

Chi W., Hua X., Chen X., Bian F., Yuan X., Zhang L., Wang X., Chen D., Deng R., Li Z., Liu Y., de Paiva C.S., Pflugfelder S.C, & Li D.Q. (2017). Mitochondrial DNA Oxidation Induces Imbalanced Activity of NLRP3/NLRP6 Inflammasomes by Activation of Caspase-8 and BRCC36 in Dry Eye. Journal of autoimmunity, 80, 65-76.

+ Open protocol

+ Expand

Ube3a-Ats Expression Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissue was immersed in 350 μl of TRIzol (Zymo Research, Catalog #R2050-1-200) and sonicated using a Dismembrator Sonicator (Thermo Fisher Scientific, Waltham, MA, United States) at setting 3 for 10 s. Sonicated tissue was then centrifuged at 10,000 × g relative centrifugal force (rcf) and supernatant was removed and incubated with an equivalent volume of 100% molecular grade ethanol, then RNA was extracted following Direct-Zol RNA Extraction (Zymo Research, San Diego, CA, United States, Catalog #R2053). cDNA was generated using RevertAid Random Hexamer (Thermo Fisher Scientific, Waltham, MA, United States, Catalog # K1691). Ten nanograms of cDNA was probed with TaqMan Universal PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, United States, Catalog #4304437) including probes for Ube3a-Yfp (Thermo Fisher Scientific, Waltham, MA, United States, Catalog #10344-1-AP) and mGAPDH (Thermo Fisher Scientific, Waltham, MA, United States, Catalog MA1-16757) on a StepOne Plus (Applied Biosystems, Foster City, CA, United States). Ube3a-Ats qPCRs were assessed with probes for the 5′ Ube3a-Ats (Ube3a-Ats 5′ F – ACAGAACA ATAGGTCACCAGGTT and Ube3a-Ats 5′ R – AAGCAAGAC TGTTCACCTCAT) and 3′ Ube3a-Ats (Ube3a-ATS 3′ F – CCAA TGACTCATGATTGTCCTG and Ube3a-Ats 3′ R – GTGAT GGCCTTCAACAATCTC). Data are presented as 2^–ΔΔCt normalized to Scr-MSC control group.

Deng P., Halmai J.A., Beitnere U., Cameron D., Martinez M.L., Lee C.C., Waldo J.J., Thongphanh K., Adhikari A., Copping N., Petkova S.P., Lee R.D., Lock S., Palomares M., O’Geen H., Carter J., Gonzalez C.E., Buchanan F.K., Anderson J.D., Fierro F.A., Nolta J.A., Tarantal A.F., Silverman J.L., Segal D.J, & Fink K.D. (2022). An in vivo Cell-Based Delivery Platform for Zinc Finger Artificial Transcription Factors in Pre-clinical Animal Models. Frontiers in Molecular Neuroscience, 14, 789913.

+ Open protocol

+ Expand

Quantifying Transcripts in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using the RNeasy spin column kit (Qiagen), plus DNase treatment to eliminate gDNA. cDNA was generated with SuperScript III (Invitrogen), and quantitative RT-PCR was performed using Taqman Universal PCR Master Mix (Applied Biosystems). The following Taqman assays (Life Technologies) were used: mOlig2 (Mm01210556_m1), mGAPDH (Mm99999915_g1), hTP53 (Hs01034249_m1) and hGAPDH (Hs02758991_g1).

Bressan R.B., Dewari P.S., Kalantzaki M., Gangoso E., Matjusaitis M., Garcia-Diaz C., Blin C., Grant V., Bulstrode H., Gogolok S., Skarnes W.C, & Pollard S.M. (2017). Efficient CRISPR/Cas9-assisted gene targeting enables rapid and precise genetic manipulation of mammalian neural stem cells. Development (Cambridge, England), 144(4), 635-648.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Mouse Cell Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR was performed as described recently (Qadir et. al 2017) . In brief, total RNA was extracted using QIAzol Lysis reagent (Qiagen Sciences) and RNA concentration was measured using a NanoDrop 2000. 1-2 μg of total RNA was used to generate cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Gene expression in mouse cells was quantified using specific primers from Life technologies for mGAPDH (Mm99999915_g1), Exon9 specific mCD95 (Mm01204974_m1), Exon 1-2 specific mCD95 (Mm00433237_m1), mCD95L (Mm00438864_m1) mSTAT1 (Mm01257286_m1), mPLSCR1 (Mm01228223_g1), mBMI1, (Mm03053308_g1), mZEB1 (Mm00495564_m1) and mZEB2 (Mm00497196_m1) using of the comparative ΔΔCT method and expressed as fold differences.

Qadir A., Guégan J., Ginestier C., Chaïbi A., Bessede A., Charafe‐Jauffret E., Macario M., Lavoué V., Rouge T.D.L.M., Law C., Vilker J., Wang S., Stroup E.K., Schipma M.J., Bridgeman B., Murmann A.E., Ji Z., Legembre P., & Peter M.E. (2021). Tumor expressed CD95 causes suppression of anti-tumor activity of NK cells in a model of triple negative breast cancer.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!