Tapestation dna screentape d1000

The Illumina NGS workflow we used to capture the integrated HBV sequences was described elsewhere [23 (link)]. Briefly, 1 ug of genomic DNA was fragmented by adaptive focused acoustic technology (AFA; Covaris) and then repaired; an ‘A’ was ligated to the 3’ end, Agilent adaptors were ligated to the fragments, and the adaptor-ligated product was PCR-amplified. We captured HBV using 250 ng of DNA library according to the standard Agilent SureSelect Target Enrichment protocol. Hybridization of capture bait was performed at 65 °C using a heated cycler lid option at 105 °C for 24 h. The purified product was quantified according to the manufacturer’s instructions (qPCR quantification protocol guide) and qualified using the TapeStation DNA screentape D1000 (Agilent). Finally, we did paired-end 100-bp read-length sequencing of the purified captured DNAs by Illumina HiSeq 2500 (Illumina, San Diego, CA, USA) following the manufacturer’s instructions.

Three rats were randomly chosen from each group (Con, EtOH, MWF200, and Sily200). The colonic contents were collected into sterile tubes and stored at −80 °C. The DNA was extracted using a PowerSoil DNA isolation kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturer’s instructions. A sequenced sample was prepared according to the Illumina 16S Metagenomic Sequencing Library protocols. Subsequently, the 16S rRNA genes were amplified utilizing 16S V3–V4 primers. The resulting PCR products were normalized and pooled using the PicoGreen. The size of the libraries was verified using the TapeStation DNA screentape D1000 (Agilent Technologies, Inc., Santa Clara, CA, USA). Subsequently, the libraries were sequenced using the MiSeq™ platform (Illumina, San Diego, CA, USA), and the pair-end reads were assembled using FLASH (1.2.11) and analyzed by QIIME (v1.9) to perform the microbial community comparison. The bacterial community richness, evenness, and diversity were measured using the Chao1 index, Shannon index, and inverse Simpson index, respectively [32 (link)].

The sequencing samples are prepared according to the Illumina 16S rDNA Metagenomic Sequencing Library protocols. The 16S rDNA genes were amplified using 16S rDNA V3-V4 primers (16S rDNA Amplicon PCR Forward Primer: 5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACA GCCTACGGGNGGCWGCAG; 16S rDNA Amplicon PCR Reverse Primer: 5′ GTCTCGTGGGC TCGGAGATGTGTATAAGAGA CAGGACTACHVGGGTATCTAATCC). Input gDNA was amplified with 16S rDNA V3-V4 primers, and a subsequent limited cycle amplification step was performed to add multiplexing indices and Illumina sequencing adapters [39 (link)]. The final products were normalized and pooled using the PicoGreen, and the size of libraries were verified using the TapeStation DNA screentape D1000 (Agilent). And sequencing (2 × 300) was done using the MiSeq™ platform (Illumina) according to the standard protocol.

For identifying microbial composition, we conducted 16 S rRNA gene sequencing, as previously described^{9 (link)}. The DNA quantification and quality assessment was done by PicoGreen and Nanodrop, respectively. Input gDNA was amplified with 16 S V3–V4 primers. To add multiplexing indices and Illumina sequencing adapters, limited‐cycle amplification was performed. The 16S V3–V4 primers were as follows: forward, 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3′ and reverse, 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3′. We normalized and pooled the final products using PicoGreen. The library size was verified using the TapeStation DNA screentape D1000 (Agilent). We then sequenced the DNA using the MiSeq™ platform (Illumina, San Diego, CA, USA) and the data was analyzed using QIIME version 1.9.0^{22 (link)}.
Low-quality reads with incorrect primer sequences or ambiguous bases were excluded. Using the unique nucleotide barcodes, the reads were classified into groups. We normalized the read count to the corresponding copy number of 16S rRNA genes^{23 (link)}. Taxonomic assignment were performed based on a 97% similarity with the GreenGenes database (version 13.5) using QIIME.
DNA sequences obtained from this study have been deposited in the National Center for Biotechnology Information short read archive under the Accession No. SRP109017.

To sequence the 16S rRNA gene amplicons, the Illumina MiSeq platform was used through the following steps. First, the random fragmentation of the DNA samples which was followed by 5′ and 3′ adapter ligation, was conducted to prepare the sequencing library. When preparing the library, dual indices and Illumina sequencing adapters were attached to the 16S rRNA gene amplicons, using the Nextera XT Index Kit (Illumina, San Diego, CA, USA). On the final step, the products were normalized and pooled to measure the concentrations of DNA using PicroGreen (Turner BioSystems, Inc., Sunnyvale, CA, USA); the verification of the library size was conducted using the TapeStation DNA ScreenTape D1000 (Agilent Technologies, Inc., Santa Clara, CA, USA). Conditions of PCR cycling were as follows: 3 min initial denaturation at 95 °C, 8 amplification cycles (95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, and a 5 min final elongation at 72 °C.