Si nc

Manufactured by Tsingke

Sourced in China

The Si-NC is a laboratory equipment product. It functions as a silicon nanocrystal generator.

Automatically generated - may contain errors

Lab products found in correlation

12 protocols using si nc

Silencing IGF2BP3 in Rheumatoid Arthritis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RA-FLSs were isolated from RA synovium. The cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Grand Island, NY, USA) supplemented with 15% foetal bovine serum (FBS) (Thermo, USA) and cultured at 37°C in 5% CO₂ and saturated humidity. The ethics committee of China-Japan Friendship Hospital approved the research (approval number 2021-153-K111).
To silence the expression of IGF2BP3, an IGF2BP3 siRNA (siIGF2BP3) and a control siRNA (siNC) were chemically synthesized by Tsingke Biotechnology Co., Ltd (Beijing, China) and transfected into RA-FLSs and RAW 264.7 cells. The siIGF2BP3 target sequences are shown below: human si-IGF2BP3, 5’- GCAAAGGATT CGGAAACTT -3’; mouse si-Igf2bp3, 5’- GGAGGUGCUGGAUAGUUUACU -3’. JetPRIME^® Transfection Reagent was used for cell transfection (Polyplus Transfection, USA).

Geng Q., Cao X., Fan D., Gu X., Zhang Q., Zhang M., Wang Z., Deng T, & Xiao C. (2022). Diagnostic gene signatures and aberrant pathway activation based on m6A methylation regulators in rheumatoid arthritis. Frontiers in Immunology, 13, 1041284.

+ Open protocol

+ Expand

Glioma cell line culture and TLR1 knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Glioma cell lines (NHA, A172, U87, U251, T98, LN229) were acquired from the cell bank of the Chinese Academy of Sciences (Shanghai). RPMI 1640 (Gibco, Gaithersburg, MD, United States) was cultured with 10% fetal bovine serum (HyClone, Logan, United States) and 1% penicillin/streptomycin (Gibco) in an incubator at 37°C and 5% CO₂. Transfections were performed applying OPTI-MEM (Invitrogen) and Lipofectamine 3000 by the manufacturer’s instructions. The siTLR1-1 (5′- AACACAACTAACTACAGATTACA -3′), siTLR1-2 (5′-ACUGAUAUCAAGAUACUGGAT-3′) and siNC were bought from Tsingke (Nanjing, China) and introduced into cells at a concentration of 50 nM. The transfected cells were harvested at 24 h after transfection.

Lu L., Hu Y., Wang C., Jiang F, & Wu C. (2021). Methylation and Expression of the Exercise-Related TLR1 Gene Is Associated With Low Grade Glioma Prognosis and Outcome. Frontiers in Molecular Biosciences, 8, 747933.

+ Open protocol

+ Expand

Silencing TRAF5 in Vascular Smooth Muscle Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-TRAF5 small interfering RNA (si-TRAF5) and siRNA negative control (si-NC) were synthesized by Tsingke Biotechnology Co., Ltd (Guangzhou, China). VSMCs were transfected using Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA, USA) for 48 h. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to assess the effectiveness of the si-TRAF5 transfection. The sequences of the siRNA used in this study are shown in Supplementary Table 1.

Peng Z., Wang K., Wang S., Wu R, & Yao C. (2023). Identification of necroptosis-related gene TRAF5 as potential target of diagnosing atherosclerosis and assessing its stability. BMC Medical Genomics, 16, 139.

+ Open protocol

+ Expand

Silencing A20 in Macrophages Infected with Giardia

Check if the same lab product or an alternative is used in the 5 most similar protocols

Knockdown of A20 in PMs was performed using anti-A20 small interfering RNA (si A20; 5’-GGGUAGGUUUGAAGACUUAtt-3’). We acquired siA20 and the nontargeting control siRNA (scrambled siRNA; siNC) from TsingKe Biological Technology (Beijing, China). Several groups were included: untreated, lipofectamine6000-treated (lipo6000; Beyotime, Shanghai, China), Giardia-treated; lipo6000 + Giardia-treated, siNC-treated, siNC + Giardia-treated, siA20-treated, and siA20 + Giardia-treated. PMs were transfected at 70% confluence using siRNA at a concentration of 50 nM and lipo6000. In brief, siRNA and lipo6000 were diluted separately in OPTI-MEM medium (Gibco, Carlsbad, CA, USA), and then mixed at a 1:1 ratio and incubated for 5 min. At 48 h after siRNA transfection, qPCR and immunoblotting assays were performed to detect the silencing efficiency. Successfully transfected cells were treated with trophozoites for 12 h for further analysis.

Liu L., Yang Y., Fang R., Zhu W., Wu J., Li X., Patankar J.V, & Li W. (2021). Giardia duodenalis and Its Secreted PPIB Trigger Inflammasome Activation and Pyroptosis in Macrophages through TLR4-Induced ROS Signaling and A20-Mediated NLRP3 Deubiquitination. Cells, 10(12), 3425.

+ Open protocol

+ Expand

STAT3 Knockdown in A375 and SK-ML-28 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

A375 and SK-ML-28 cells were seeded into 12-well plates (3–5 × 10⁴ cells per well) or 6-well plates (1–1.5 × 10⁵ cells per well), and small interfering RNA (siRNA) was transfected with Lipofectamine 8,000 reagent (Beyotime). Three STAT3-specific siRNAs (si-STAT3-1, si-STAT3-2, and si-STAT3-3) were used to knock down STAT3, and non-silencing siRNAs (si-NC) were used as a negative control (Tsingke, Beijing, China). siRNAs were transfected at the final RNA concentration of 50 nM and cultured for 48 h/72 h for further experiments. The human siRNA sequence transfected in this study is as follows:
STAT3-1: sense, 5′-CACAAUCUACGAAGAAUCATT-3′;
Antisense, 5′-UGAUUCUUCGUAGAUUGUGTT-3′.
STAT3-2: sense, 5′-GUCAUUAGCAGAAUCUCAATT-3′;
Antisense, 5′-UUGAGAUUCUGCUAAUGACTT-3′.
STAT3-3: sense, 5′-CCAACAAUCCCAAGAAUGUTT-3′;
Antisense, 5′-ACAUUCUUGGGAUUGUUGGTT-3′.

Zhang R.S., Li Z.K., Liu J., Deng Y.T, & Jiang Y. (2022). WZB117 enhanced the anti-tumor effect of apatinib against melanoma via blocking STAT3/PKM2 axis. Frontiers in Pharmacology, 13, 976117.

+ Open protocol

+ Expand

Silencing of ATG5 and NCOA4 in HTR8/Svneo Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small interfering (si)-ATG5, si-NCOA4, and a negative control siRNA (si-NC) were synthesized by Tsingke Biotechnology (Beijing, China). The FTH1-EGFP plasmid, the ATG5 overexpression plasmid, the NCOA4 overexpression plasmid, and a negative control overexpression plasmid (OE-NC) were synthesized by Hanbio Biotechnology (Shanghai, China). HTR8/Svneo cells at 60–70% confluency was transfected with 100 nM siRNA or 1 mg of plasmids in the presence of Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) in six-well plates according to the manufacturer’s instructions. The siRNA sequences used in this study are listed in Table S2.

Yang H., Zhang X., Ding Y., Xiong H., Xiang S., Wang Y., Li H., Liu Z., He J., Tao Y., Yang H, & Qi H. (2022). Elabela: Negative Regulation of Ferroptosis in Trophoblasts via the Ferritinophagy Pathway Implicated in the Pathogenesis of Preeclampsia. Cells, 12(1), 99.

+ Open protocol

+ Expand

Circular RNA Regulation in Breast Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

The breast cancer cell line (MCF-7) and normal mammary epithelial cell line (MCF-10A) were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences. MCF-7 cells were cultured in DMEM (Boster, Wuhan, China) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Gibco, CA, United States). MCF-10A cells were kept in DMEM/F12 (Procell, Wuhan, China) supplemented with 20 ng/ml epidermal growth factor, 0.5 μg/ml hydrocortisone, 5% horse serum and 1% penicillin/streptomycin. Both cell lines were maintained in a humidified incubator at 37°C with 5% CO₂.
Small interfering RNA (siRNA) targeting circ_0008812 (si-circ8812: ACGAGUGCACUUGGUGAAAUU), circ_0001583 (si-circ1583: CAAAGAAGGCCAAGGUUAAUU) and negative control (si-NC) were generated by Tsingke Biotechnology (Chengdu, China). MCF-7 cells were transfected using Lipofectamine 3000 (Invitrogen) for 48 h.

Lin H., Long F., Zhang X., Wang P, & Wang T. (2022). Upregulation of circ_0008812 and circ_0001583 predicts poor prognosis and promotes breast cancer proliferation. Frontiers in Molecular Biosciences, 9, 1017036.

+ Open protocol

+ Expand

Establishment of PCOS cell model

Check if the same lab product or an alternative is used in the 5 most similar protocols

KGN human granulosa cells were obtained from Procell Life Science & Technology Co., Ltd. and incubated in DMEM/F12 (Procell Life Science & Technology Co., Ltd.) at 37°C with 5% CO₂. The medium contained 10% FBS (Thermo Fisher Scientific, Inc.) and 100 U/ml penicillin/streptomycin (Thermo Fisher Scientific, Inc.). The PCOS cell model was established by treating cells with dihydrotestosterone (DHT) solution (500 nM) for 24 h. Next, 100 nM small interfering RNA (siRNA/si)-TNC and 100 nM si-NC (both TsingKe Biological Technology) were transfected into KGN cells for 48 h at 37°C using Lipofectamine^® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). The medium was replaced with fresh medium and the cells were cultured for another 24 h. The siRNA sequences were as follows: si-TNC, sense 5′-CGGUGUAUAUUAAGUGCUAGU-3′ and antisense 5′-UAGCACUUAAUAUACACCGGG-3′; and si-NC, sense 5′-UUCUCCGAACGUGUCACGUTT-3′ and antisense 5′-ACGUGACACGUUCGGAGAATT-3′.

Wu H., Yang M., Yan C., Liu M., Wang H, & Zhang W. (2024). Tenascin C activates the toll‑like receptor 4/NF‑κB signaling pathway to promote the development of polycystic ovary syndrome. Molecular Medicine Reports, 29(6), 106.

+ Open protocol

+ Expand

Kidney Cell Line Culture Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

ccRCC cell lines (786-O, HEK293 T, Caki-1, ACHN) and normal kidney cell lines (HK-2) were acquired from the cell bank of Chinese Academy of Sciences (Shanghai). RPMI 1640 (Gibco, Gaithersburg, MD., USA) was cultured with 10% fetal bovine serum (HyClone, Logan, USA) and 1% penicillin/streptomycin (Gibco) in an incubator at 37°C and 5% CO₂. Transfections were performed applying OPTI-MEM (Invitrogen) and Lipofectamine 3000 according to manufacturer's instructions. si-FOXD2-AS1 and siNC were bought from Tsingke (Nanjing, China) and introduced into cells at a concentration of 50 nM. The transfected cells were harvested at 24 h after transfection. All primers and the sequence of siRNA are listed at Table S3.

Tang X., Zhang A., Feng Y., Su Y., Wang X., Jiang F, & Ma J. (2021). A Novel Pyroptosis-Related lncRNAs Signature for Predicting the Prognosis of Kidney Renal Clear Cell Carcinoma and Its Associations with Immunity. Journal of Oncology, 2021, 9997185.

+ Open protocol

+ Expand

Targeted Knockdown of Epigenetic and Signaling Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small interfering RNAs (siRNAs) targeting the Kdm4e (si-Kdm4e), Dux4 (si-Dux4), and scramble siRNA (si-NC) genes were constructed by Tsingke Biotechnology Co., Ltd. (Beijing, China). Cells grown to 60% confluence were transfected with these siRNAs using Xfect RNA transfection reagent (TaKaRa, 631450) according to the manufacturer’s protocol. The final concentrations of siRNAs was 100 pM. Adenoviruses carrying short hairpin RNAs targeting the Rptor gene (sh-Rptor#1 and sh-Rptor#2) or a scramble RNA (sh-NC) were constructed by Hanbio Co., Ltd. (Shanghai, China). Cells at 60% confluence were transfected with sh-Rptor#1, sh-Rptor#2, or sh-NC for 8 h at an MOI of 50. The medium was removed and fresh medium added, and the cells were then cultured for 48 h before use in experiments. The siRNA and shRNA sequences are listed in supplementary Table 3.

Zhang F., Hu G., Chen X., Zhang L., Guo L., Li C., Zhao H., Cui Z., Guo X., Sun F., Song D., Yan W., Xia Y., Wang S., Fan M, & Tao L. (2022). Excessive branched-chain amino acid accumulation restricts mesenchymal stem cell-based therapy efficacy in myocardial infarction. Signal Transduction and Targeted Therapy, 7, 171.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!