Trizol reagent

Total RNA was extracted from mouse kidney tissues and RAW264.7 cells using TRIzol reagent (Axygen; Corning Incorporated, NY, USA) according to the manufacturer’s protocol. Purified RNA (1 µg/µl) was reverse-transcribed into cDNA using a Script cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., CA, USA) at 37 °C for 15 min and at 98 °C for 5 min. RT-qPCR was carried out using a Bio-Rad CFX96 Optics Real-Time PCR System (Bio-Rad Laboratories, Inc., CA, USA). cDNA was amplified by polymerase chain reaction using specific primers (Table 1). The following PCR conditions were used for AQP1 and β-actin: 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 10 s, and extension at 72 °C for 15 s. The AQP1 and β-actin primers produced amplified products of 129 and 70 bp, respectively.Table 1

Primers used in the qPCR analysis

Primer	Sequence
AQP1	Forward primer 5′-CCTGCTGGCCATTGACTACA-3′
AQP1	Reverse primer 5′-TGGTTTGAGAAGTTGCGGGT-3′
β-Actin	Forward primer 5′-CGCGAGTACAACCTTCTTGC-3′
β-Actin	Reverse primer 5′-CGTCATCCATGGCGAACTGG -3′

Total tissue RNA was separated by TRIzol reagent (Corning, USA), cDNA was retrieved and mRNA expression was measured using the SYBR Premix EX Taq II kit (Takara, Japan), and the 2^−△△Ct method was adopted to analyse relative gene expression.

Proteins were extracted from cells using RIPA lysis buffer with proteinase inhibitor. Then, proteins were separated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% milk and 0.01% Tween-20 in tris-buffered saline (TBS; pH 7.6) and incubated with TMEM92 antibody diluted at 1:500 in TBS overnight at 4°C. GAPDH was used as an internal control. Protein quantification was performed in ImageJ.
RNA extraction and cDNA synthesis were performed using the TRIzol reagent (Corning co, USA) and PrimeScript RT Reagent Kit (Promega, Beijing, China), respectively. mRNA expression levels of TMEM92 were quantified using the SYBR Premix Ex Taq system (Promega, Beijing, China), with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression levels serving as a normalization control. The relative levels of TMEM92 were determined using the comparative quantification cycle (Cq) method (2−ΔΔCq) based on three repeated measurements. The primers used in this study are listed below:

RAW264.7 cells (5 × 10⁵) were challenged with LPS for 24 h followed incubation with DHL (0, 3, 5, 15 and 30 μmol/L) for 30 mins. The lung macrophages were challenged with LPS for 8 h and 16 h followed incubation with DHL (0, 3, 5, 15 and 30 μmol/L) for 30 mins. Lung tissues from LPS induced mice model with or without DHL treatment were collected and homogenized. Total RNA were extracted using TRIzol reagent (Corning, Shanghai, China). cDNA was was synthesized by ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) and amplified by realtime PCR on a StepOne Plus system (Thermo Fisher Scientifc, Waltham, MA, USA) with primer sets for iNOS (forward, 5′-CCCTTCAATGGTTGGTACATGG-3′; reverse, 5′-ACATTGATCTCCGTGACAGCC-3′), TNF-α (forward, 5′-TTCTCATTCCTGCTTGTGG-3′; reverse, 5′-ACTTGGTGGTTTGCTACG-3′), IL-6 (forward, 5′-CCACCAAGAACGATAGTCAA-3′; reverse, 5′-TTTCCACGATTTCCCAGA-3′), IL-12p35 (forward, 5′- GGACCAAACCAGCACAT-3′; reverse, 5′- CGCAGAGTCTCGCCATTA-3′), IL-12p40 (forward, 5′- TGAACTGGCGTTGGAAG-3′; reverse, 5′- GAAGTAGGAATGGGGAGTG-3′), IL-1β (forward, 5′-CCAGCTTCAAATCTCACAGCAG-3′; reverse, 5′-CTTCTTTGGGTATTGCTTGG GATC-3′), and GAPDH (forward, 5′-TGCGACTTCAACAGCAACTC-3′; reverse, 5′-CTTGCTCAG TGTCCTTGCTG-3′). The relative expression (defined as fold change) of target gene was given by 2-△△Ct and normalized to the GAPDH.

After polygraphic recordings and sleep–wake states analysis were done, hypothalamus tissues of mice (10 were chosen from each group randomly) were collected and homogenized. Total RNA was extracted using TRIzol reagent (Corning, Shanghai, China). cDNA was synthesized using ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) and amplified by real-time PCR on a StepOne Plus system (Thermo Fisher Scientific, Waltham, MA, USA) with primer sets for Orexin A (forward, 5′- GCCTCAGACTTCTTGGGTATTT-3′; reverse, 5′- AGGGAACCTTTGTAGAAGGAAA -3′) and GAPDH (forward, 5′-TGCGACTTCAACAGCAACTC-3′; reverse, 5′-CTTGCTCAGTGTCCTTGCTG-3′). The relative expression (defined as fold change) of the target gene was given by 2^−△△Ct and normalized to GAPDH. At least triplicate independent experiments were performed.