Anti digoxigenin ap

Genomic DNA was extracted from the transgenic and non-transgenic in vitro-grown poplar plants. Twenty µg of genomic DNA was fully digested by BamHI or HindIII by overnight incubation. The resultant DNA fragments were electrophoresed, transferred to the nylon membrane, and hybridized with the DIG-labeled fragment of HPTII synthesized by the PCR reaction using a PCR DIG Probe Synthesis Kit (Roche, Basel, Switzerland). The signals were detected via chemical luminescence using Anti-Digoxigenin-AP, Fab fragments from sheep (Roche), and CDP-Star^® (Roche) by exposure for 140 min.

For ISH and immunostainings, fish were sacrificed, eyes dissected and fixed in 4% paraformaldehyde/ 0.1 M PBS after removal of the lens. Eyes were embedded in gelatin/sucrose and sectioned (14 µm) with a cryostat. The serpine3 in situ probe spans the coding exons 3–8 (transcript: ENSDART00000132915.2). Using primers with restriction enzyme cut sites (forward, Not1: TAAGCA GC GGCCGCGTAAAAGTGCCCATGATGTACCAG, reverse, BamHI: TAAGCA G GATCC ACAACTCGACCTATAAACAGCAAC), serpine3 cDNA was amplified from total cDNA and cloned into the pCRII-topo vector (Invitrogen). The antisense probes were transcribed with SP6 polymerase, using a DIG-labeled NTP mix (Roche diagnostics). The (fluorescent) ISH were conducted as previously described with minor modifications (de Oliveira-Carlos et al., 2013 (link)): Hybridization and washing steps were performed at 60 °C. For chromogenic in situs, sections were incubated with anti-digoxigenin-AP (Roche), diluted 1:4000 in DIG-blocking reagent (Roche) at 4 °C overnight and subsequently developed with NBT/BCIP (Roche). For FISH, sections were washed in PBS immediately after quenching. Sections were blocked for 1 hr with 2% blocking reagent in MABT (Perkin-Elmer) and then incubated with anti-digoxigenin-POD (Roche), diluted 1:500. The signal was detected with the TSA Plus Cy3/Cy5 kit (Perkin-Elmer).

Embryos were obtained from ascl1b-2A-Cre/+, olig2-2A-Cre+ and neurod1-2A-Cre/+ outcrossed to wild type WIK, and placed in embryo media with 0.003% 1-phenyl 2-thiourea (PTU) at 24 h post fertilization to block pigment production. Whole mount in situ hybridization was performed as described previously^{52 (link)}. 3 dpf larvae were fixed overnight at 4 °C in 4% paraformaldehyde or 4% paraformaldehyde/4% sucrose in PBS. neurod1, olig2 and ascl1b cDNAs were cloned by RT-PCR using total RNA isolated from 3 dpf embryos and SuperScript III (Invitrogen). Primers for reverse transcription and PCR are listed in Supplementary Table S2. Digoxigenin-labeled probes were generated from linear plasmid DNA using DIG RNA Labeling Mix (Roche) and hybridized probes were detected with anti-digoxigenin antibody (Anti-Digoxigenin-AP, Roche) and NBT/BCIP (Roche). Larvae were imaged on a Zeiss Axioskop 2 and photographed with a Cannon Rebel T3 camera. Larvae for live imaging were placed in embryo media with 0.003% 1-phenyl 2-thiourea (PTU) at 24 h post fertilization to block pigment production. At 2 or 3 dpf the PTU treated embryos were anesthetized in 160ug/ml tricaine methane sulfonate and mounted in 1.2% low-melting agarose/160ug/ml tricaine methane sulfonate. Images were captured on a Zeiss LSM 700 or Zeiss LSM 800 laser scanning confocal microscope.