Color reverse transcription kit

Total RNA was extracted from cells using an RNA Purification Kit (EZ Bioscience) in accordance with the manufacturer's protocol, followed by measurement of RNA concentration. For reverse transcription mRNAs of ALP, Runx2, CCAAT/enhancer binding protein α (C/EBPα), CD31 and VEGF, cDNA was synthesized from 1 μg of total RNA using a color reverse transcription kit (EZ Bioscience). Then quantitative PCR was performed using a SYBR Green PCR master mix kit (EZ Bioscience). GAPDH was used as the reference gene, and the primer sequences (BioTNT) of the genes above are listed in Table S1. The following cycling conditions were utilized for RT-PCR: 95℃ for 5 min, followed by 40 cycles at 95℃ for 10 s and 60℃ for 30 s. The relative expression of mRNAs was calculated by the 2^-△△Ct method.

Total RNA was extracted from rat colon tissue using the over-column method according to the manufacturer’s instructions. RNA reverse transcription was performed using the color reverse transcription kit (EZBioscience). Quantitative PCR was performed using 2×color SYBR Green qPCR Master Mix (EZBioscience) in Roche LightCyclerTM 480. Standardization was performed using β-actin. The amplification and melting curves were confirmed at the end of the reaction and the data were calculated using the 2^-ΔΔCt method (Table 2).

The total RNA from the liver and EAT was isolated using the Tissue RNA Purification Kit PLUS (EZBioscience, Roseville, CA, USA), following the manufacturer’s instructions. The amount and quality of the RNA were determined using a spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The Color Reverse Transcription Kit (EZBioscience, Roseville, CA, USA) was used to convert 1 μg of RNA into cDNA. Gene expression was quantified by RT-qPCR reaction using the Light Cycler96 system (Roche). RT-qPCR was performed according to the instructions provided by the 2 × Color SYBR Green qPCR Mix kit (EZBioscience, Roseville, CA, USA). The total volume of the reaction was 20 μL, including 10 μL SYBR Green mix, 2 μL cDNA, 7.2 μL H₂O and 0.4 μL each of forward and reverse primers. The amplification conditions included denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Finally, a melting curve analysis was performed. The primers are listed in Supplementary Table S1. β-actin was used as a housekeeping gene to normalize target gene transcript levels. The values were expressed using the formula 2^−(ΔΔCt), where ΔΔCt = (Ct Target-Ct β-actin) treatment—(Ct Target-Ct β-actin) model.

On day 28 following PBOO operation, the animals were sacrificed and the bladders were removed guaranteeing the bladder weight. The bladder was sliced into longitudinal detrusor strips and divided into three sections for RT-qPCR, Western blot, and histological test. RT-qPCR was used to quantify the expression of SLC17A9 and ChAT. The methods were conducted as described in a previous article^{32 (link)}, using an EZ-press RNA Purification Kit, Color Reverse Transcription Kit, and 2*Color SYBR Green qPCR Master Mix (ROX2 plus), from EZBioscience, USA. Table 2 contains a list of primer pairs. Results were standardized using the expression of GAPDH.
Table 2

Primers used for RT-qPCR.

Gene	Primers (5′–3′)
SLC17A9—F	GCTTCCTCAAGGCTATGATCTT
SLC17A9—R	AGGTCCTGAATGTTGACTGAAA
ChAT-F	TGGCCATACCCAGGACACA
ChAT-R	TCCAAGACAAAGAACTGGTTGCA
GAPDH-F	TGAGCATCTCCCTCACAATTCC
GAPDH-R	TTTTTGAGGGTGCAGCGAAC

Total RNA was extracted with an EZ-press RNA Purification Kit (EZBioscience, USA). Total RNA was reverse transcribed to cDNA using the Color Reverse Transcription Kit (EZBioscience, USA) following the manufacturer’s instructions. Reverse transcription was performed at 42 °C for 15 min and 95 °C for 30 s.
MiR34a expression was measured with Color SYBR Green qPCR Master Mix (EZBioscience, USA) by using the Roche LightCycler96 Real-Time PCR system (Roche Applied Science, Rotkreuz, Switzerland). The amplification program was 40 cycles of denaturing at 95 °C for 10 s, annealing at 60 °C for 30 s, and extension at 60 °C for 30 s. MiR-34a and U6 were purchased from RiboBio (Guangzhou, China). The sequences of specific primers were used as follows:
miR-34a forward:5’-ACACTCCAGCTGGGTGGCAGTGTCTTAGCTGGT-3’,
Reverse:5’-CTCAACTGGTGTCGTGGA-3’;U6forward:5’-GCTTCGGCAGCACATATACTAA-3’, reverse: 5’-AACGCTTCACGAATTTGCGT-3’. The expression level of miR-34a was defined from the Ct. U6 was used as an endogenous control. The 2^−ΔΔt method was used for relative quantification after normalization.

Total RNA from goose tissues, cell lines, and strains was extracted using Trizol (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. Next, messenger RNAs were reverse transcribed to cDNAs using the Color Reverse Transcription Kit (EZBioscience, Shanghai, China). A quantitative real‐time polymerase chain reaction (qRT-PCR) was performed to measure gene expression. The cycle threshold values obtained from samples were compared using the 2^–ΔCt method. For the detection of goose and cell line genes, β-actin served as the internal reference gene. For the detection of LGG genes, 16S rRNA served as the reference gene. All primers are listed in Supplementary Table 1.