All 11 exons of BEST1 gene were sequenced by Sanger direct sequencing method to obtain sequences for all coding sequences, the noncoding Exon 1, and 50bp of adjacent intronic sequences of each exon. Primer sequences are available on request. Messenger RNA was isolated from venous blood using QIAamp RNA Blood Mini Kit (QIAGEN Cat. No. 75142) with a fast spin-column procedure. Genomic DNA is eliminated by pre-treating the RNA sample with DNase I, Amplification Grade (Invitrogen Cat. No. 18068-015 DNase I Amplification Grade; Invitrogen, Carlsbad, CA). The primer pair was designed to encompass BEST1 Exons 1 and 2. Forward primer was in the Exon 1 of BEST1, 5′ACCAGCCTAGTCGCCAGA3′ (1) and the reverse primer in the Exon 2 of BEST1, 5′GCGGATGATGTAGTAGCAGAG3′ (2). The final concentration for each primer was 0.2 μmol. The thermal cycling conditions were established using a ABI 9700 thermocycler (Applied Biosystems, Foster City, CA). Efficient complementary DNA synthesis was achieved in a 30-minute incubation at 55° C. Polymerase chain reaction (PCR) amplification consisted of 40 cycles of 94°C for 15 seconds, 65° C for 30 seconds, and 68°C for 1 minute. We used 1 cycle 68°C for 5 minutes for final extension.
Dnase 1 amplification grade
Manufactured by Thermo Fisher Scientific
Sourced in United States, Spain, Germany, France, Australia, Japan
DNase I Amplification Grade is a high-purity enzyme used to remove DNA contamination from RNA samples. It is designed to effectively degrade DNA without affecting the integrity of RNA.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (71 mentions)
Trizol, by Thermo Fisher Scientific (41 mentions)
Nanodrop, by Thermo Fisher Scientific (22 mentions)
Rneasy mini kit, by Qiagen (21 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (20 mentions)
Iscript cdna synthesis kit, by Bio-Rad (18 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (17 mentions)
High capacity cdna archive kit, by Thermo Fisher Scientific (16 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (15 mentions)
Random hexamer, by Thermo Fisher Scientific (15 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (14 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (14 mentions)
Rnaseout, by Thermo Fisher Scientific (11 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (11 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (10 mentions)
Superscript 2, by Thermo Fisher Scientific (10 mentions)
Rneasy kit, by Qiagen (10 mentions)
Tri reagent, by Merck Group (10 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (9 mentions)
Superscript 3, by Thermo Fisher Scientific (9 mentions)
323 protocols using dnase 1 amplification grade
1
Sanger Sequencing of BEST1 Gene
2
Macroalgae RNA Extraction and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Macroalgae samples 1–6 (0.40, 0.46, 0.37, 0.30, 0.81, and 0.96 g wet weight, respectively) were disrupted in liquid nitrogen with a mortar. Regarding dsRNA purification, samples were suspended in 2× STE (0.2 M Tris–HCl, 0.2 M NaCl, and 2 mM EDTA, pH 6.8) containing 0.1% (v/v) β-mercaptoethanol, and total nucleic acids were manually extracted with SDS-phenol. dsRNA was purified twice through a Poly-Prep Empty Chromatography Column (Bio-Rad) and microspin column (empty Bio-spin column; Bio-Rad) containing cellulose powder (Cellulose D; ADVANTEC). To remove the remaining DNA and ssRNA, eluted dsRNA was further treated with amplification grade DNase I (Invitrogen) and S1 nuclease (Invitrogen) as described previously (Urayama et al., 2018 (link)).
To purify ssRNA, part of the pulverized sample was treated with a TRIzol Plus RNA Purification Kit (Invitrogen) according to the manufacturer’s protocol. The total ssRNA fraction was treated with amplification grade DNase I (Invitrogen) and purified using RNA Clean & Concentrator-5 (Zymo Research).
To purify ssRNA, part of the pulverized sample was treated with a TRIzol Plus RNA Purification Kit (Invitrogen) according to the manufacturer’s protocol. The total ssRNA fraction was treated with amplification grade DNase I (Invitrogen) and purified using RNA Clean & Concentrator-5 (Zymo Research).
3
Fungal RNA Extraction and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fungal mats (fresh weight, 100 mg) were disrupted in liquid nitrogen in a mortar or using FastPrep 24 (MP Biomedicals Inc., OH, USA). dsRNA and ssRNA purification was performed as described previously (Urayama et al., 2020; Urayama et al., 2018; Urayama et al., 2016) . In brief, total nucleic acids were manually extracted from the ground cells with sodium dodecyl sulfate-phenol. dsRNA was purified using the cellulose resin chromatography method (Morris and Dodds, 1979; Okada et al., 2015) and subjected to AGE analysis. To obtain sequence-grade dsRNA, the remaining DNA and ssRNA were removed with amplification grade DNase I (Invitrogen, Carlsbad, CA, USA) and S1 nuclease (Invitrogen). Total RNA was extracted from the pulverized samples using the TRIzol Plus RNA Purification Kit (Invitrogen), and the eluted RNA was treated with amplification grade DNase I (Invitrogen) and purified using RNA Clean & Concentrator-5 (Zymo research, Irvine, CA, USA).
4
Cloning and Transcription of HIV-1 Integrase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Preliminary RT-LAMP assay development and optimisation was undertaken using cloned RNA transcripts of the complete HIV-1 integrase (IN) coding region. The IN coding region of the 8E5 strain of HIV-1 (clade B) was amplified by nested PCR using primers 5′-CTCACAGTATGCATTAGGAATYAT and 5′-CCTTATGGCAGATTCTGAAAAACA in the first round and 5′-GCACACAAAGGAATTGGAGGAAAT and 5′-TAGTGGGATGTGTACTTCTGAACT in the second round. The PCR products were cloned into the pCR 2.1-TOPO Vector (Life Technologies, Paisley, UK). DNA was extracted using a Plasmid Minikit (Qiagen, Manchester, UK) and the plasmid linearized by digestion with restriction enzyme Pst1 (New England Biolabs, Hitchin, UK). RNA transcripts were made using the MEGAScript T7 polymerase kit (Life Technologies) according to the manufacturer’s instructions. Post-transcription, the nucleic acid was DNAse digested (DNAse 1 amplification grade, Life Technologies) for 30 minutes at 37 °C and RNA extracted with the QIAamp viral RNA kit (Qiagen).
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following quality analysis and quantification, 1 μg RNA was treated with DNase 1, amplification grade (Life Technologies) and reverse transcribed using the SuperScript III First Strand Synthesis SuperMix Kit (Life Technologies) according to the manufacturer’s instructions. Gene expression was then analyzed commercially using the Fluidigm 96.96 BioMark HD System (Ramaciotti Gene Analysis Centre, Randwick, NSW, Australia) as per manufacturer’s instructions. The NormFinder algorithm45 (link) was used to compare 5 endogenous control genes included on the array (TBP, ACTB, GAPDH, IPO8 and SDHA), identifying TBP as being the most stable control gene. Relative expression of target genes was determined using the 2−delta-delta Ct method (Fluidigm Real-time PCR analysis software), normalizing expression to TBP and a commercial pooled normal brain control sample (calibrator; Ambion, Life Technologies).
Genes of interest were then validated in triplicate using the Applied Biosystems 7900HT real time PCR system and individual TaqMan assays following the manufacturer’s instructions. Results were analyzed using Data Assist Software v3.0 (Life Technologies) and fold changes in each individual gene expression were calculated independently using the 2−delta-delta Ct method after normalizing to TBP.
Genes of interest were then validated in triplicate using the Applied Biosystems 7900HT real time PCR system and individual TaqMan assays following the manufacturer’s instructions. Results were analyzed using Data Assist Software v3.0 (Life Technologies) and fold changes in each individual gene expression were calculated independently using the 2−delta-delta Ct method after normalizing to TBP.
6
HeLa Cell Fractionation and mRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells were transfected as described above and were described earlier [5 (link)]. For cell fractionation studies, the nuclear and cytoplasmic fractions were prepared as previously described prior to western analysis [15 (link),65 (link)] and performed at least twice for each type of experiment. RNA was purified using TriZol and Trizol LS. 1 µg of total RNA was treated with DNAse I Amplification Grade (Life Technologies) and first strand cDNA synthesis was performed using Superscript II RT (Life Technologies). 2 µL of total cDNA was taken and PCR amplified for gapdh mRNA and vRNA using the primers described in Abrahamyan etal. [61 (link)]. mCherry mRNA was amplified using a specific primer pair (Forward primer, 5'-TGG AGG GCT CCG TGA ACG GCC and reverse primer 5'-TAG GCG CCG GGC AGC TGC ACG) to generate a RT-PCR product of about 483 bp. Signal intensities of PCR signals (cycle 25–30) were quantitated exactly as described above [61 (link),62 (link)] using ethidium bromide stained DNA signals captured in-gel. All calculations were performed by taking into account the gapdh mRNA signal intensities.
7
qRT-PCR for Retrotransposon Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT–PCR for retrotransposons was conducted using published primer sets45 (link). One microgram total RNA was treated with DNAse I Amplification Grade (Life Technologies) and converted to cDNA using SuperScript II Reverse transcriptase and random hexamers as primer (Life Technologies). The samples were digested with RNAse H in accordance with manufacturer’s protocol. RT–PCR was then performed using iQ SYBR Green Mastermix (BioRad) with 750 nM concentration of each primer. The samples was amplified (PCR programme: 95 °C 10:00, 50x (95 °C 30s, 55 °C 30s, 72 °C 30s)) with detection of PCR product after each elongation step and determination of melting temperature after the completion of PCR. The reaction was performed using an Agilent Technologies Mx3005p qPCR System (Stratagene). Upregulation of transposon transcript in the mutant is estimated using difference of squares with glyceraldehyde 3-phosphate dehydrogenase as a control.
8
Quantitative RT-PCR of Retrotransposons
9
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells and tissues using TRIzol reagent (Life Technologies) according to the manufacturer’s protocol. After treating with DNase I, Amplification Grade (Life Technology), RNA was retrotranscribed with Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, United States). cDNA was amplified using GoTaq® DNA Polymerase kit (Promega), in a Veriti® Thermal Cycler (Applied Biosystems, Life Technology). Primers and conditions used are listed in Supplementary Table 2 . No template controls containing water instead of cDNA were included in each PCR run. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and 60s ribosomal protein L19 (RPL19) housekeeping genes were used as internal controls. After PCR amplification, the PCR product was analyzed by electrophoresis in agarose gels, with SYBR® Safe DNA Gel Stain (10,000×) (Thermo Fisher Scientific) and visualized using a Gel Doc system (ChemiDocTM XRS + System, Bio-Rad).
10
Antioxidant and Cytotoxicity Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dimethylsulfoxide, quercetin, 5,5′-dithio-bis (2-nitrobenzoic acid), acetylcholine iodide, 1-chloro-2,4-dinitrobenzene, 2′,7′-dichlorofluorescein diacetate (DCHF-DA), Folin-Ciocalteu, HEPES minimum 99.5% titration, 2,4,6–tris(2-pyridyl)-5-triazine (TPTZ), resazurin sodium salt, albumin from bovine serum (BSA), sucrose, reduced glutathione, tetramethylethylenediamine, and quercetin were purchased from Sigma-Aldrich (São Paulo, SP, Brazil). DNAse I Amplification Grade, SYBR Select Master Mix, and TRIzol were obtained from Life Technologies; iScript cDNA Synthesis kit was obtained from Biorad (CA, USA). Griess reagent system and Caspase-Glo 3/7 and caspase 9 were purchased from Promega (WI, USA). Mancozeb (80% purity, Enzeb 800 WP) was purchased from Sabero Organics America SA (Belo Horizonte, MG, Brazil). All other reagents were commercial products of the highest purity grade available.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!