PXB cells were infected with 3 genome equivalents per cell of HBV C_AT [23 (link)], and the medium was exchanged every 3 or 4 days. After 28 days of infection, the cells were treated with 100 μM CDM-3008 and 10,000 IU/ml IFNα (Sumitomo Dainippon Pharma) in dHCGM for 7 days. After infection and treatments, the cellular DNA was then purified using the Agencourt DNAdvance System (Beckman Coulter). 3D-PCR was performed according to standard hepatitis B virus methods and protocols [25 ]. Briefly, cccDNA was amplified from the purified DNA by PCR (PCR Thermal Cycler Dice Touch, Takara) using specific primers designed for HBV C_AT sequence (forward primer: 5’-AGAGCTGAGGCGGTGTCGAG-3’ , reverse primer: 5’-ACCTATTGATTGGAAAGTATGT-3’ ) and KOD One PCR Master Mix (Toyobo). The HBx region was amplified by nested PCR using specific primers (forward primer: 5’-ATGGCTGCTARGCTGTGCTGCCAA-3’ , reverse primer: 5’-AAGTGCACACGGTYYGGCAGAT-3’ ) and KOD One PCR Master Mix (Toyobo) with gradient of denaturation temperature (80–92 °C). The nested PCR products were separated by 2% agarose gel electrophoresis, visualized with ethidium bromide, subcloned using the Zero Blunt TOPO PCR cloning kit (Thermo Fisher), and sequenced using the BigDye Terminator v3.1 sequencing kit (Thermo Fisher).
Kod one pcr master mix
Manufactured by Toyobo
Sourced in Japan, China
KOD One PCR Master Mix is a ready-to-use solution for performing Polymerase Chain Reaction (PCR) experiments. It contains the necessary components, including the KOD DNA polymerase, dNTPs, and reaction buffer, optimized for efficient DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Mce 202 multina, by Shimadzu (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
T100 thermal cycler, by Bio-Rad (4 mentions)
Applied biosystems 3130xl genetic analyzer, by Thermo Fisher Scientific (3 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (3 mentions)
In fusion hd cloning kit, by Takara Bio (3 mentions)
Epitect bisulfite kit, by Qiagen (3 mentions)
Zero blunt topo pcr cloning kit, by Thermo Fisher Scientific (2 mentions)
Qiaquick gel extraction kit, by Qiagen (2 mentions)
Primestar max dna polymerase, by Takara Bio (2 mentions)
Pgl4.17 luc2 neo vector, by Promega (2 mentions)
Primestar mutagenesis basal kit, by Takara Bio (2 mentions)
Snapgene, by GSL Biotech (2 mentions)
Verso cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Universal mirna cloning linker, by New England Biolabs (2 mentions)
Clonexpress multis one step cloning kit, by Vazyme (2 mentions)
Clonexpress ultra one step cloning kit, by Vazyme (2 mentions)
Qiaprep spin miniprep kit, by Qiagen (2 mentions)
Chelex 100 resin, by Bio-Rad (2 mentions)
Nucleospin dna rapidlyse kit, by Macherey-Nagel (2 mentions)
94 protocols using kod one pcr master mix
1
Characterization of HBV cccDNA and HBx in PXB cells
2
Citrus Cultivar Identification via InDel Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 185 InDel markers published in previous research (Fang et al. 2018 , Kawahara et al. 2020 (link)) were applied for the screening of polymorphic InDel fragments specific to the target cultivar using genomic DNA of 26 citrus cultivars (Table 1 ). A single polymorphic InDel fragment or a minimum combination of polymorphic InDel fragments was screened to identify the target cultivar among the 26 cultivars. The PCR mixture was prepared in at a final volume of 10 μL, containing 5 ng of genomic DNA, 5 pmol of the forward and reverse primers, and 5 μL of KOD One PCR Master Mix (TOYOBO, Osaka, Japan). The cycling conditions were as follows: 32 cycles of denaturation at 98°C for 10 s, annealing at 56°C for 5 s, and extension at 68°C for 2 s and one cycle of final extension at 68°C for 30 s. All reactions were performed on the ProFLEX PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The PCR products were electrophoresed on 2.0% agarose gel (Agarose standard 01, Solana; Rikaken, Nagoya, Japan) and visualized through ethidium bromide staining.
3
RT-PCR and Sequence Analysis of dsRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AaV1 dsRNA was heat-denatured at 98°C for 5min and immediately chilled on ice for at least 5min. The SuperScript III First-strand synthesis system (Invitrogen) was used for first-strand cDNA synthesis, and then, PCR was performed using the KOD One™ PCR Master Mix (TOYOBO). The PCR conditions were as follows: 95°C for 3min followed by 35cycles of 95°C for 45s, 55°C for 30s, and 72°C for 45s. The PCR products were then analyzed by electrophoresis in 1% agarose gels containing EtBr (0.5μg/ml). The primer pairs used are listed in Supplementary Table S1 .
After electrophoresis, the predicted PCR bands were extracted from the agarose gels and purified using the GENECLEAN II Kit (MP Biomedical). EX-Taq was used for A-tailing, and the PCR products were then cloned into the pCR™ 4-TOPO™ TA-cloning Vector (Invitrogen). The cloned PCR products were sequenced using the BigDye Terminator v3.1cycle sequencing kit (Applied Biosystems) and the Applied Biosystems 3130xl Genetic Analyzer (Applied Biosystems) according to the manufacturer’s protocols. The sequences were analyzed with MegAlign software (Lasergene7, DNA-STAR®, WI, United States).
After electrophoresis, the predicted PCR bands were extracted from the agarose gels and purified using the GENECLEAN II Kit (MP Biomedical). EX-Taq was used for A-tailing, and the PCR products were then cloned into the pCR™ 4-TOPO™ TA-cloning Vector (Invitrogen). The cloned PCR products were sequenced using the BigDye Terminator v3.1cycle sequencing kit (Applied Biosystems) and the Applied Biosystems 3130xl Genetic Analyzer (Applied Biosystems) according to the manufacturer’s protocols. The sequences were analyzed with MegAlign software (Lasergene7, DNA-STAR®, WI, United States).
4
Cloning and Sequencing of CRISPR Target Sites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA fragments encompassing the target sites of the crRNAs (Cas9 otx2b_AA/Cas12a otx2b_02, Cas9 pax2a_AB, Cas9 pou2_AG, Cas12a sox2_01, Cas9 sox3_AA, Cas9 sox11a_AB, Cas12a sox11b_01, and Cas12a sox19b_01) were amplified using KOD One PCR Master Mix (Toyobo, Osaka, Japan) and the primers listed in Supplementary Table S2 . These fragments were cloned into the pUC19 vector using the restriction sites included in the primers. Sanger sequencing was performed to identify the indel sequences.
5
RNA Extraction and Gene Expression Analysis in Rice Leaves
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the flag leaf lamina joints after 60 days of growth using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Reverse transcription was performed using a Reverse Tra Ace-а-First strand cDNA synthesis kit (TOYOBO). RT-PCR was performed using Taq Master Mix (Vazyme) with primers for OsARF6, OsARF17, and Actin (Supplemental Table 1 ). QRT-PCR was performed using a SYBR Green PCR kit (Qiagen) with primers for OsARF6, OsARF12, OsARF17, OsARF25, ILA1, UBQ, and TUB (Supplemental Table 1 ), where TUB and UBQ genes were used as internal controls. All cloned PCR amplifications were done with KOD One PCR Master Mix (TOYOBO) with the suggested annealing temperature (37°C) and extension time (15 min) according to fragment length (Supplemental Table S1 ). Sequences were analyzed and aligned by SnapGene (https://www.snapgene.com/ ). PCR products and vectors were purified with a QIAquick Spin miniprep kit (Qiagen). The expression vectors were constructed by In-fusion technology (https://www.takarabio.com/ ). For each construct, more than 15 independent transgenic plants were obtained. pCAMBIA1301-GFP was used as the binary vector for tagging OsARF6 or OsARF17 clones with GFP; pCAMBIA1301-GUS was used as the binary vector for expressing GUS under the control of OsARF promoters.
6
Cloning and Characterization of SLC22A12 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All plasmid constructs were designed by SnapGene (GSL Biotech, Chicago, Illinois, USA). The human genomic DNA was isolated from U2OS cells using the QuickExtract™ DNA Extraction Solution (Lucigen, Wisconsin, USA). From the gDNA, the SLC22A12 gene promoter was amplified using KOD One PCR Master Mix (TOYOBO, Osaka, Japan) or PrimeSTAR® Max DNA Polymerase (TAKARA BIO, Shiga, Japan) with primer F: gctcgctagcctcgaaatcagttccaaagagcctctaaagaag, and primer R: ccggattgccaagctagagaggcagctgctcca. After the PCR product was confirmed by the agarose gel electrophoresis, it was purified using QIAquick Gel Extraction Kit (Qiagen) and cloned into a pGL4.17 [luc2/Neo] Vector (Promega, Madison, Wisconsin, USA) using Xho I and Hind III restriction enzyme sites. The ERE sequences of SLC22A12 gene promoter were amplified to get mutants (TGACC was changed to CAGTA) using PrimeSTAR Mutagenesis Basal Kit (TAKARA BIO, Shiga, Japan) with the following primers: ERE#1 primer F: aagcaggattcagtacaagggctcgcagtgcgt; primer R: cgagcccttgtactgaatcctgcttaaaagcca; ERE#2 primer F:ccagacactgcagtatgagaggccatagctgag; primer R: tggcctctcatactgcagtgtctggcctggaac; ERE#3 primer F: cagctgccagcagtacaagcccacacagagact; and primer R: tgtgggcttgtactgctggcagctgcccagccc. The constructs were amplified, and sequences were confirmed.
7
Constructing bFMO-Expressing Recombinant Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The recombinant strains harboring bFMO from Methylophaga aminosulfidovorans were constructed using plasmid pET28a stocked in our lab. Escherichia coli BL21(DE3) was purchased from TransGen Biotech Co. (Beijing, China). (Choi et al. 2003 (link)) Indigo, indirubin, and indole were purchased from Aladdin Co., China. Dpn I was purchased from Thermo Fisher (Thermo Fisher Scientific, USA). KOD One™ PCR Master Mix was purchased from TOYOBO (TOYOBO Life Science, Japan). Hieff clone Plus One Step Cloning kit was purchased from YEASEN (YEASEN Biotechnology Co., Shanghai, China). All the other chemicals were commercially available. The tryptophan medium contained 5 g/L yeast extract, 10 g/L NaCl, 2 g/L tryptophan. The cysteine medium contained 5 g/L yeast extract, 10 g/L NaCl, 2 g/L tryptophan, 0.36 g/L cysteine.
8
Extraction and Cloning of miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNAzol RT from 293T cells 24 hours after transfection. Universal miRNA Cloning Linker (#S1315S, NEB) was linked to the 3′-terminus of RNA using T4 RNA Ligase 2, truncated K227Q (#M0351S, NEB). Then, cDNA was synthesized using Verso cDNA Synthesis Kit (#AB1453, Thermo Fisher Scientific) and PCR was performed using KOD One PCR Master Mix (#KMM-101, TOYOBO). Resulting PCR fragments were cloned into pSP73 and verified by sanger sequencing. Primers are listed in S3 Table.
9
Total RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from seedlings using NucleoSpin® RNA Plant (Takara Bio.) which includes DNase I treatment. Reverse transcription was performed using a PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio.), and PCR was performed using KOD One® PCR Master Mix (TOYOBO) and the RT product as a template. Thirty-five cycles of PCR were performed for detection of RTs and 30 cycles for detection of the first genes in 20 μl reaction volume. Primers used for PCR are listed in Supplementary Table 2 . PCR products were loaded onto a 1.5% agarose gel and electrophoresed in TBE buffer followed by detection under ultra-violet (UV) light using GelRed stain (Nacalai Tesque, Japan). As size markers, Gene Ladder 100 (Nippon Gene) or GD 1Kb plus DNA ladder RTU (GeneDireX) were used.
10
Cloning and Mutagenesis of NPR1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CDS coding region of NPR1 was amplified using primers (5′-CATTTACAATTATCGATATGGACACCACCATTGATGGATTC-3′, 5′-TGCTCACCATGGATCCCCGACGACGATGAGAGAGTTTAC-3′) by PCR with KOD One PCR master mix (TOYOBO). The amplified fragment was cloned in-frame with c-terminal eGFP and placed under the control of the CaMV 35S promoter of epiGreenB binary vector63 (link). Site-directed mutagenesis was performed using In-Fusion cloning method according to the manufacturer’s instruction (In-Fusion HD cloning Kit; Takara Bio). Agrobacterium tumefaciens C58C1 strains carrying the binary vectors were grown in LB liquid medium overnight. Cultures were centrifuged, and the pellets were washed once and resuspended in infiltration buffer (10 mM MES-NaOH, pH 5.6, 10 mM MgCl2, and 100 μM acetosyringone). Infiltration of Agrobacterium was done at OD600 = 0.3 and protein was extracted 2 days after infection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!