At different time points of differentiation, RNA samples were extracted by using High Pure RNA Isolation Kit (Roche) and converted into complementary cDNA with Transcriptor High Fidelity cDNA Synthesis Kit (Roche). Real-time quantitative PCR (qPCR) was performed using the StepOneTM or the ViiATM 7 RT-PCR Systems (Applied BioSystems). Taqman® Gene Expression Assays (20X, Applied Biosystems) were selected for NANOG, PAX6, TBR1, DLX2, NKX2.1, LHX6, FOXG1 and GAPDH. DLL1, HES5, PARVALBUMIN (PV), VGLUT1 and GAPDH analysis were performed using the SYBR Green Master Mix (Nzytech). The results were analyzed with the StepOneTM or the QuantStudioTM RT-PCR Software. All PCR reactions were done in duplicate or triplicate and then normalized to the housekeeping gene GAPDH. The fold change was calculated using the 2ΔCt method and in some graphical results it was calculated relatively to the control condition levels obtained. The representative heatmaps were generated using the web tool Clustvis (Metsalu and Vilo, 2015 (link)).
Sybr green master mix
Manufactured by NZYTech
Sourced in United States
SYBR green master mix is a ready-to-use solution for real-time PCR amplification and detection. It contains SYBR green, a fluorescent dye that binds to double-stranded DNA, as well as all the necessary reagents for PCR, including DNA polymerase, dNTPs, and buffers.
Automatically generated - may contain errors
Lab products found in correlation
Nzy first strand cdna synthesis kit, by NZYTech (3 mentions)
Rneasy kit, by Qiagen (2 mentions)
Cfx384 touch real time pcr detection system, by Bio-Rad (2 mentions)
Viia7 rt pcr system, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assays 20x, by Thermo Fisher Scientific (1 mentions)
Stepone, by Thermo Fisher Scientific (1 mentions)
Transcriptor high fidelity cdna synthesis kit, by Roche (1 mentions)
High pure rna isolation kit, by Roche (1 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Stepone software, by Thermo Fisher Scientific (1 mentions)
5 protocols using sybr green master mix
1
Quantifying Neural Lineage Markers
2
Quantitative RT-PCR Analysis of Porcine Viral Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PAM were seeded in p60 plates (6 × 106 cells/plate) and mock or infected with Arm07/CBM/c2 (WT) or NH/P68 (4 PFU/cell) in DMEM 10% porcine serum. At 8 or 16 hpi, the total RNA was extracted from cells using an RNeasy kit (Qiagen). cDNA was synthesized using a NZY first-strand cDNA synthesis kit (NZYTech). qPCR was performed using 12.5 ng of cDNA for each sample in a 384 plate and was run in CFX384 touch real-time PCR detection system (Bio-Rad) with SYBR green master mix (NZYTech). Gene expression levels were normalized to the housekeeping gene (18S rRNA), and these values were relative to the mock values. The primers used were 5′-GGCCCGAGGTTATCTAGAGTC -3′ and 5′-TCAAAACCAACCCGGTCA -3′ for porcine 18S rRNA detection and 5′-ACTTCCTAAGCCTTACAGTCGT -3′ and 5′-AGTGGTTGTGTTGAGGGACG -3′ for viral EP402R detection. Biological and experimental triplicates were used.
3
Quantifying Porcine IFN-β and Viral Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PAM were seeded in p60 plates (6·× 106 cells/plate) and mock or infected with Arm07/CBM/c2 (WT) or Arm-ΔCD2v-ΔA238L (3 PFU/cell) in DMEM–10% porcine serum. At 4, 8 or 16 hpi, the total RNA was harvested from cells using a RNeasy kit (Qiagen, Hilden, Germany). cDNA was synthesized using a NZY first-strand cDNA synthesis kit (NZYTech, Lisbon, Portugal). qPCR was performed using an CFX384 touch real-time PCR detection system (Bio-Rad, Hercules, CA, USA) with SYBR green master mix (NZYTech). Gene expression levels were normalized to the housekeeping gene (18S rRNA), and these values were relative to the mock values. The primers used were 5′-GGCCCGAGGTTATCTAGAGTC-3′ and 5′-TCAAAACCAACCCGGTCA-3′ for porcine 18S rRNA detection, 5′-GTGGAACTTGATGGGCAGAT-3′ and 5′-TTCCTCCTCCATGATTTCCTC-3′ for porcine IFN-β detection, 5′-ACTTCCTAAGCCTTACAGTCGT-3′ and 5′-AGTGGTTGTGTTGAGGGACG-3′ for viral EP402R detection and 5′-GCAGATCCGACTCAAAAAGACT-3′ and 5′-ACTCCATATTTCCTGTAAAGACTGC-3′ for viral A238L detection. Biological and experimental triplicates were used.
4
Quantification of FUT gene expressions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extracts from cell lysates were obtained using TRIZOL Reagent (Life Technologies). RNA (3 µg) was converted into cDNA using the SuperScript IV Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions. FUT2, FUT3, FUT4, and FUT8 mRNA expressions were quantified through quantitative real‐time polymerase chain reaction (qRT‐PCR) using SYBrGreen Master Mix (NZYTech). Target mRNA levels were normalized to β‐actin housekeeping gene. Primer sequences are listed in Table S1 (Supporting Information). The acquired data have been calculated using the ΔCT approach.
5
Quantitative PCR Analysis of Zebrafish Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol reagent according to the manufacturer's instructions. RT was performed using the NZY first-strand cDNA synthesis kit (NZYtech). Quantitative PCR was performed in a 96-well optical plate using SYBR green master mix (NZYtech). PCR and data acquisition were performed using the AB7300 Real-Time PCR thermal cycler with Step One software (v2.2.2; Applied Biosystems). eef1al1 (eukaryotic elongation factor 1 alpha like 1) and rpl13a (ribosomal protein L13a) were used as housekeeping genes to normalize the mRNA expression levels. Target gene expression was determined by relative quantification (ΔΔCt method) to the housekeeping reference genes and the control sample.
The following zebrafish forward and reverse primers were used:
v-cam1 (TTGCAGTTGTTTCCCACACG; CCTAACGCGGTCCAGACAAA),
il-1β (GTAACCTGTACCTGGCCTGC; AACAGCAGCTGGTCGTATCC),
il-6 (ACGTGAAGACACTCAGAGACG; CGTTAGACATCTTTCCGTGCTG),
tnf-α (CAGGGCAATCAACAAGATGG; TGGTCCTGGTCATCTCTCCA),
il-10 (GCTCTGCTCACGCTTCCTTC; TGGTTCCAAGTCATCGTTGT)
eef1a1l1 (CCTTCAAGTACGCCTGGGTGTT; CACAGCACAGTCAGCCTGAGAA),
rpl13a (TGACAAGAGAAAGCGCATGGTT; GCCTGGTACTTCCAGCCAACTT).
The following zebrafish forward and reverse primers were used:
v-cam1 (TTGCAGTTGTTTCCCACACG; CCTAACGCGGTCCAGACAAA),
il-1β (GTAACCTGTACCTGGCCTGC; AACAGCAGCTGGTCGTATCC),
il-6 (ACGTGAAGACACTCAGAGACG; CGTTAGACATCTTTCCGTGCTG),
tnf-α (CAGGGCAATCAACAAGATGG; TGGTCCTGGTCATCTCTCCA),
il-10 (GCTCTGCTCACGCTTCCTTC; TGGTTCCAAGTCATCGTTGT)
eef1a1l1 (CCTTCAAGTACGCCTGGGTGTT; CACAGCACAGTCAGCCTGAGAA),
rpl13a (TGACAAGAGAAAGCGCATGGTT; GCCTGGTACTTCCAGCCAACTT).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!