Analyses of q-PCR were performed as previously described [20 (link)]. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. HiScript Q RT SuperMix for q-PCR kit (Vazyme, Nanjing, China) was used for reverse transcription polymerase chain reactions, and then q-PCR assays were conducted with SYBR Green I mix (Takara, Dalian, China) on an ABI ViiA 7 Q-PCR System (Applied Biosystems, Waltham, MA). In all cases, mRNA levels were normalized to the expression of GAPDH, which served as an endogenous control. The relative expression of target genes was calculated by the 2-△△Ct method [22 (link)]. The primer sets used in this study are listed in Additional file 1 : Table S2.
Hiscript q rt supermix for qpcr kit
Manufactured by Vazyme
Sourced in China
HiScript Q RT SuperMix for qPCR Kit is a reverse transcription and real-time PCR reagent kit designed for sensitive and accurate quantification of RNA targets. The kit includes a high-performance reverse transcriptase and a optimized qPCR master mix.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Sybr green real time pcr master mix, by Vazyme (4 mentions)
Chamq sybr qpcr master mix, by Vazyme (4 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (3 mentions)
Trizol, by Vazyme (3 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Chamq sybr qpcr master mix kit, by Vazyme (2 mentions)
Aceq qpcr sybr green master mix high rox premixed, by Vazyme (2 mentions)
Ultrasybr mixture, by CWBIO (2 mentions)
Mirneasy mini kit, by Qiagen (2 mentions)
Chamq sybr color qpcr master mix, by Vazyme (2 mentions)
Rnaeasy animal rna isolation kit, by Beyotime (2 mentions)
Sybr green master mix, by Vazyme (2 mentions)
Abi 7300 real time pcr detection system, by Thermo Fisher Scientific (2 mentions)
Ultrasybr mixture kit, by CWBIO (2 mentions)
Rnaiso plus total rna kit, by Transgene (2 mentions)
Dnase 1, by Takara Bio (2 mentions)
Aceq qpcr sybr green master mix, by Vazyme (2 mentions)
Abi viia7 qpcr system, by Thermo Fisher Scientific (1 mentions)
32 protocols using hiscript q rt supermix for qpcr kit
1
qPCR Quantification of Target Genes
2
Quantifying EGFR and PARP Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cell lines using RNAiso Plus reagent (Takara, Dalian, China) and reverse transcribed using the HiScript® QRT SuperMix for qPCR kit (Vazyme). Then, qRT-PCR was performed using the SYBR® qPCR Master Mix kit (Vazyme). The primer sequences used for specific gene amplification were as follows:
EGFR primer:
Forward – CGGGCTCTGGAGGAAAAGAA
Reverse – TGCGTGAGCTTGTTACTCGT
PARP primer:
Forward – CCCCACGACTTTGGGATGAA
Reverse – AGACTGTAGGCCACCTCGAT.
EGFR primer:
Forward – CGGGCTCTGGAGGAAAAGAA
Reverse – TGCGTGAGCTTGTTACTCGT
PARP primer:
Forward – CCCCACGACTTTGGGATGAA
Reverse – AGACTGTAGGCCACCTCGAT.
3
RNA Extraction and qRT-PCR Analysis for Camellia sinensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of C. sinense ‘Red Sun’ was extracted by RNA extraction kit (TIANGEN, Biotech, Beijing, China). The content of RNA in three samples was determined by nanodrop2000 (Thermo Fisher, Waltham, MA, USA). 500 ng RNA was taken from each sample for reverse transcription by HiScript Q RT SuperMix for qPCR kit (Vazyme Biotech Co., Nanjing, China) to obtain cDNA. cDNA dilution of 10-folds was used for qRT-PCRanalysis.
QRT-PCR used CFX96TM Real-Time System (Bio-Rad, Hercules, CA, USA) following the instructions based on ChamQ SYBR qPCR Master Mix kit (Vazyme Biotech Co., Nanjing, China). CsACTIN was used as normalization standard for gene expression. The gene expression was calculated by 2−ΔΔCT. The primers for qRT-PCR are listed inTable S5 .
QRT-PCR used CFX96TM Real-Time System (Bio-Rad, Hercules, CA, USA) following the instructions based on ChamQ SYBR qPCR Master Mix kit (Vazyme Biotech Co., Nanjing, China). CsACTIN was used as normalization standard for gene expression. The gene expression was calculated by 2−ΔΔCT. The primers for qRT-PCR are listed in
4
RNA Isolation, RNase R Treatment, and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAiso Plus (TaKaRa, Tokyo, Japan) was utilized to isolate total RNA from tissue samples and cells. For RNase R treatment, total RNA of CC cells was incubated with 3 U/μg RNase R (Geneseed) for 15 min at 37°C. For complementary DNA generation, total RNA was reversely transcribed with the HiScript Q RT SuperMix for qPCR Kit (Vazyme, Nanjing, China) or commercial miR reverse transcription PCR kit (RiboBio). The synthesized complementary DNA was used for qRT-PCR in the CFX96 Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA) with the SYBR Green PCR Master Mix (Bio-Rad) based on previous studies.24 (link),25 (link). The following primers were used: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (F:5ʹ-GACTCCACTCACGGCAAATTCA-3ʹ; R:5ʹ-TCGCTCCTGGAAGATGGTGAT-3ʹ), hsa_circ_0084927 (F:5ʹ-TTGTAAGTGAGGAGCACCGAGAC-3ʹ; R:5ʹ-CGTGCCCTGACTACGGTGTTAT-3ʹ), ESRP1 (F:5ʹ-TGCGTTGAGGAAGCATAAAG-3ʹ; R:5ʹ-GGGTTGGAAGTGGAATGAGA-3ʹ), TPD52 (F:5ʹ-AGCATCTAGCAGAGATCAAGCG-3ʹ; R:5ʹ-AGCCAACAGACGAAAAAGCAG-3ʹ), miR-634 (F:5ʹ-CAGTCTCAAACCAGCACC-3ʹ; R:5ʹ-TATGGTTGTTCACGACTCCTTCAC-3ʹ), and U6 small nuclear RNA (U6) (F:5ʹ-GCTCGCTTCGGCAGCACA-3ʹ; R:5ʹ-GAGGTATTCGCACCAGAGGA-3ʹ). Relative expression levels were figured with the 2−ΔΔCt method, and GAPDH or U6 was used as an internal control for hsa_circ_0084927, ESRP1, TPD52, and miR-634.
5
Western Blot and qRT-PCR Analysis of TNBC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total protein of the TNBC cells was extracted via RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors. The total protein was separated via 8–15% SDS-PAGE and transferred onto a PVDF membrane (Millipore). Then, the total protein was incubated with 5% BSA for 1 h at room temperature to block the PVDF membranes. The primary antibodies were incubated overnight at 4°C, and then, the PVDF membranes were incubated with secondary antibody for 1 h at room temperature. The antigen–antibody complexes were detected by an enhanced chemiluminescence (ECL).
TRIzol reagent (Vazyme, Nanjing, China) was used to isolate the total cellular RNA. Reverse transcription of RNA into cDNA was performed using the HiScript QRT SuperMix for qPCR Kit (Vazyme, Nanjing, China), and the cDNA was amplified using an RT-PCR amplification kit (Vazyme, Nanjing, China). The primers were designed using Primer Premier 5 software (primer sequences are shown inTable 1 ). The 2−ΔΔCt method was used to perform the analysis with β-actin as the reference gene.
TRIzol reagent (Vazyme, Nanjing, China) was used to isolate the total cellular RNA. Reverse transcription of RNA into cDNA was performed using the HiScript QRT SuperMix for qPCR Kit (Vazyme, Nanjing, China), and the cDNA was amplified using an RT-PCR amplification kit (Vazyme, Nanjing, China). The primers were designed using Primer Premier 5 software (primer sequences are shown in
6
Quantitative Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cell lines and matched primary and normal mucosa tissues from GC patients was extracted using TRIzol reagent (Invitrogen, California, USA). cDNA was reverse transcribed from 2 μg of total RNA using a HiScript qRT SuperMix for qPCR kit (Vazyme, Nanjing, China) according to the manufacturer’s instructions. qRT-PCR was performed using a ChamQ SYBR qPCR Master Mix kit (Vazyme, Nanjing, China). The primers used are listed in Table 2 . GAPDH was used as an internal control. The mRNA levels were calculated using the 2−(ΔCt sample–△ΔCt control) method, and all experiments were run in triplicate.
Sequences of primers for quantitative reverse transcription-PCR.
| Gene | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| PCDHGA9 | GCTCATTTCGGTGGAAGAT | CACTGGGCTAAACAGAGAT |
| E-cadherin | AGGCCAAGCAGCAGTACATT | CATTCACATCCAGCACATCC |
| Slug | TCTTCACTCCGAAGCCAAAT | TCTGTGGGTGTGTGTGTGTG |
| Vimentin | CGAAACTTCTCAGCATCACG | GCAGAAAGGCACTTGAAAGC |
| N-cadherin | TTTGAGGGCACATGCAGTAG | ACTGTCCCATTCCAAACCTG |
| Twist | GCCAGGTACATCGACTTCCTCT | TCCATCCTCCAGACCGAGAAGG |
| GAPDH | GGGAAGGTGAAGGTCGGAGT | GGGGTCATTGATGGCAACA |
7
Knockdown of circHIPK2 Using RNA Interference
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The circ-control siRNA-GFP lentivirus and circHIPK2 siRNA-GFP lentivirus based on the sequence 5′-UACCGGUAUGGCCUCACAUTT-3′ were purchased from HANBIO (Shanghai, China). The circ-control shRNA-eGFP AAV and circHIPK2 shRNA-eGFP AAV based on the sequence 5′-UACCGGUAUGGCCUCACAUTT-3′ were obtained from OBIO (Shanghai, China). TRIzol® reagent was purchased from TAKARA BIO INC (9109, Kusatsu, Shiga, Japan). HiScript Q RT SuperMix for qPCR Kit (R123-01) and AceQ qPCR SYBR Green Master Mix (High ROX Premixed) (Q141-02) were purchased from Vazyme Biotech (Nanjing, China). Oligonucleotide primers for real-time polymerase chain reaction (PCR) were synthesized by Invitrogen (Shanghai, China)
8
Quantification of Gene Expression after Ischemic Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peri‐infarct cortex, plasma, and white blood cells (WBCs) were isolated and collected from mice after 24 h of tMCAO‐induced ischemia. Primary mouse microglia or BV2 cells were harvested immediately after inducing OGD/R. The total RNA from tissue samples and cultured cells were extracted according to the manufacturer's protocol, which utilized the Trizol method (Invitrogen) and miRNeasy Mini kit (Qiagen). The concentration of RNA was determined with a NanoPhotometer® spectrophotometer (IMPLEN, USA). For the qPCR assay, cDNA was synthesized using the HiScript® Q RT SuperMix for qPCR Kit (Vazyme, China), and subsequently, the reactions were performed in the Bio‐Rad CFX96 Real‐Time system utilizing the UltraSYBR Mixture (CWBIO, China). The cycling conditions for performing qPCR were carried out as per the manufacturer's recommended protocol, with each qPCR assay being performed in triplicate. The relative gene expression was analyzed by the 2−ΔΔCt method and normalized to GAPDH (glyceraldehyde‐3‐phosphate dehydrogenase). The primer sequences were designed and synthesized by RiBoBio (China) as described in Table S1 .
9
Quantifying GPX4 mRNA Levels via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the cells using the RNAeasy™ Animal RNA Isolation Kit (Beyotime, Cat# R0027, China) according to the manufacturer’s instructions. To synthesize cDNA, 1 μg of the isolated total RNA was used as a template in a reverse transcription reaction. The HiScript Q RT SuperMix for qPCR kit (Vazyme, Cat# R223, China) was utilized following the manufacturer’s protocol. Real-time quantitative PCR (qPCR) was performed using the ChamQ SYBR Color qPCR Master Mix (Vazyme, Cat# Q321, China) in accordance with the manufacturer’s instructions. The relative mRNA expression levels were determined using the 2−ΔΔCt method. The primer sequences used were as follows:
GPX4-Forward: CGGAATTCATGAGCCTCGGCCGCCTTTG;
GPX4-Reverse: CCGCTCGAGGAAATAGTGGGGCAGGTCCT;
GAPDH-Forward: GTCTCCTCTGACTTCAACAGCG;
GAPDH-Reverse: ACCACCCTGTTGCTGTAGCCAA.
GPX4-Forward: CGGAATTCATGAGCCTCGGCCGCCTTTG;
GPX4-Reverse: CCGCTCGAGGAAATAGTGGGGCAGGTCCT;
GAPDH-Forward: GTCTCCTCTGACTTCAACAGCG;
GAPDH-Reverse: ACCACCCTGTTGCTGTAGCCAA.
10
Quantification of mRNA Expression Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNAeasy™ Animal RNA Isolation Kit (Cat# R0027; Beyotime) following the manufacturer's instructions. The HiScript Q RT SuperMix for qPCR kit (Cat# R223; Vazyme) was utilized following the manufacturer's protocol to synthesize complementary DNA. RT‐qPCR was performed using the ChamQ SYBR Color qPCR Master Mix (Cat# Q321; Vazyme) following the manufacturer's instructions (Tables 1 and 2 ). The primer sequences used for RT‐qPCR were as follows: IGF2BP2‐Forward: AGTGGGAGGTGTTGGATGG; IGF2BP2‐Reverse: CGGTTTCTGTGTCTGTGTTG; GAPDH‐Forward: GTCTCCTCTGACTTCAACAGCG; GAPDH‐Reverse: ACCACCCTGTTGCTGTAGCCAA. To quantify the relative mRNA expression levels, the established 2 − ∆ ∆ C t
37 (link)
37 (link)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!