The largest database of trusted experimental protocols

Taqman reverse transcription reagent kit

Manufactured by Takara Bio
Sourced in Japan

The Taqman Reverse Transcription reagent kit is a set of reagents used for the reverse transcription of RNA to cDNA. The kit includes essential components necessary for the reverse transcription reaction, such as reverse transcriptase enzyme, buffer, and primers.

Automatically generated - may contain errors

2 protocols using taqman reverse transcription reagent kit

1

Liver RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Liver was homogenized and total RNA was isolated using the RNeasy kit (Qiagen, Hilden, Germany). A reverse transcription reaction was performed by Taqman Reverse Transcription reagent kit (Takara, Kusatsu, Japan) according to the manufacturer's instructions. The real-time PCR reaction was carried out on Roche real-time PCR system with cDNA sample containing SYBR Green PCR master mix (Takara) and primers. Primer sequences can be made available upon request. Relative expression of mRNA was calculated by the comparative cycle threshold method.
+ Open protocol
+ Expand
2

Quantitative RT-PCR and Western Blot Analysis of mRNA and Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
For mRNA analysis, total RNA extraction for cDNA synthesis was conducted with the Taqman Reverse Transcription Reagent kit (TaKara-Bio, Kusatsu, Japan). Real-time quantitative PCR was conducted with different primer sequences (Table 1) using SYBR Green Master Mix (TaKaRa).

Primer sequences for real time RT-PCR

TargetForwardReverse
ACTBTCTTCCAGCCTTCCTTCCTAGCACTGTGTTGGCGTACAG
CAPRIN1TCTCGGGGTGATCGACAAGAACCCTTTGTTCATTCGTTCCTGG
SLC2A1TGTCTGGCATCAACGCTGTCTTCTC CCTGCTCGCTCCACCACAAAC
HK2CGACAGCATCATTGTTAAGGAGCA GCAGGAAAGACACATCACATTT
HIF1AAGTTCCGCAAGCCCTGAAAGCGCAGTGGTAGTGGTGGCATTAGC
MYCCGCCTCTTGACATTCTCCTCGGACTATCCTGCTGCCAAGA
NUP160GTTATCTGGCTGCTCTCAATTGGTGCATTCTCCATCATGATTCC
NUP133AGTACCTGTGGGCTGCTTCTCTAGGCTCTGGTTGTCAGTCTGCTCAC
NUP155CCGCTCCTCAGTCTCCCAGTGGCTCATCCTTGGATCGCTGTGAC
METTL3CCAGCACAGCTTCAGCAGTTCCGCGTGGAGATGGCAAGACAGATG
WTAPCTGACAAACGGACCAAGTAATGAAAGTCATCTTCGGTTGTGTTG
Proteins were separated by SDS–PAGE followed by Western blot as described previously [30 (link), 31 (link)]. Anti- GAPDH (Cell Signaling Technology), anti-Caprin-1 (116 kDa, ProteinTech Group), anti-HIF1α (120 kDa, ProteinTech Group), anti-c-Myc (49 kDa, roteinTech Group), anti-WTAP (45 kDa, Santa Cruz Biotechnology), and anti-METTL3 (64 kDa, Abcam) were used as primary antibodies. HRP-conjugated anti-mouse and anti-rabbit IgG (Cell Signaling Technology) were used as secondary antibodies.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!