Eight paraffin-embedded samples from HCC patients were investigated. The reseach project was authorized by the ethical committee of the Medical University of Graz (Ref. Nr. 20-119 ex 08/09). CISH was performed using the miCURY LNATM microRNA ISH Optimization Kit (FFPE) (Exiqon, Vedbaek, Denmark) according to manufacturer’s instruction. A biotin-labeled probe was used for the detection of H19 RNA (/5BioTEG/GTCCTGTAACCAAAAGTGACCG, Exiqon, Vedbaek, Denmark). A digoxin-labeled probe of scrambled RNA served as negative control (/5DigN/GTGTAACACGTCTATACGCCCA, Exiqon, Vedbaek, Denmark) and a digoxin-labeled beta-actin probe was used as positive control (/5DigN/CTCATTGTAGAAGGTGTGGTGCCA, Exiqon, Vedbaek, Denmark). All probes were used in a concentration of 40 nM. Proteinase K digestion was done for 10 min at 37°C with 15 µg/ml Proteinase K (Roche, Mannheim, Germany). The hybridization step was performed at 56°C for 1 h in a slide hybridizer DakoCytomation (Dako, Hamburg, Germany). Nuclei were counterstained with Nuclear Fast Red Counterstain (Vector Laboratories, Burlingname, CA, USA).
Nuclear fast red counterstain
Manufactured by Vector Laboratories
Sourced in United States
Nuclear fast red counterstain is a histological stain used to visualize nuclei in tissue samples. It provides a bright red color contrast to other cellular components when used in combination with other staining techniques.
Automatically generated - may contain errors
Lab products found in correlation
5dign, by Qiagen (1 mentions)
Proteinase k, by Roche (1 mentions)
Mircury lna microrna ish optimization kits ffpe, by Qiagen (1 mentions)
Biotinylated secondary antibody, by Jackson ImmunoResearch (1 mentions)
Nbt bcip substrate, by Roche (1 mentions)
Eukitt, by Electron Microscopy Sciences (1 mentions)
Alkaline phosphatase conjugated anti fam, by Roche (1 mentions)
Freedom evo, by Tecan (1 mentions)
Dig dna labeling and detection kit, by Roche (1 mentions)
8 protocols using nuclear fast red counterstain
1
H19 Expression in Hepatocellular Carcinoma
2
In-situ Hybridization of miRNA in FFPE Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Paraffin sections were air-dried at room temperature for 1.5 h and stored at 4 °C until the day before in situ hybridization, at which point they were hotplated at 60 °C for 45 min, returned to 4 °C, and used the following day. In situ hybridization was implemented according to the guidelines stated in the miRCURY LNA microRNA ISH Optimization Kits (FFPE) protocol (Exiqon, Woburn, MA). Slides were treated with Proteinase K at 15 µg/ml for 10 min at 37 °C. Hybridization was performed at 54 °C for the following: 5′-digoxigenin (DIG) labeled (U6) and double DIG (scrambled and miR-34a), LNA-modified oligonucleotide ISH probes. The following probe concentrations were used: LNA scrambled probe (40 nM), U6 (1 nM), and miR-34a (60 nM). Positive probe labeling was blue/purple. Nuclei were visualized using Nuclear Fast Red counterstain (Vector Laboratories Inc., Burlingame, CA)
3
In situ Hybridization of miR-132
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ hybridization for miR-132 was performed by Bioneer (Denmark) as previously described43 (link). Enzymatic development using 4-nitro-blue tetrazolium (NBT) and 5-brom-4-chloro-3′-Indolylphosphate (BCIP) substrate (Roche) forming dark-blue NBT-formazan precipitate was used to visualize miR-132 in combination with nuclear fast red counterstain (Vector Laboratories, Burlingame, CA).
4
Immunohistochemistry Protocol for Tissue Sections
Check if the same lab product or an alternative is used in the 5 most similar protocols
SI Appendix includes a list of used antibodies. Immunoblotting and immunocytochemistry techniques were described previously (20 (link)). For immunohistochemistry, slide-mounted tissue sections were deparaffinized and developed in a fashion similar to that previously described (50 (link)) except that blue chromogenic substrate and nuclear fast red counterstain (Vector Laboratories) were used following diluted biotinylated secondary antibody (Jackson Immunoresearch Laboratories) and phosphatase avidin D (Vector Laboratories) incubation steps.
+ Expand
5
In Situ Hybridization of ATC Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Six µm thick paraffin sections of 4 ATC tissues (4 of the 11 ATC studied by microarrays) and of 1 normal thyroid tissue were mounted on Super frost+glass slides and deparaffinized. The slides were hybridized with 40 nM of the LNA miRNA let-7g, miR-29a and miR-30e probes (Exiqon) and the nuclei were counterstained with the nuclear fast red counterstain (Vector Laboratories, Burlingname, CA) by Bioneer as described in [19] (link). A scramble miRNA and miR-126 were used as negative and positive controls respectively. LNA-miRNA sequences are described in Table S1 .
6
In Situ Hybridization of miR-21 in MF Skin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Six μm thick tissue sections from paraffin embedded lesional MF skin biopsies were used for in situ hybridization as described elsewhere [50 (link), 73 (link)]. In brief, the slides were deparaffinized and placed in a Tecan Freedom Evo automated hybridization instrument (Tecan, Männedorf, Switzerland), which was programmed to perform the following steps: proteinase-K treatment using 15 μg/mL for 8 min at 37°C, pre-hybridization in formamide-free hybridization buffer (Exiqon, Vedbæk, Denmark) at 57°C for 15 min, in situ hybridization with double-FAM-labeled miR-21 and scramble LNA probes (both at 40nM, Exiqon) at 57°C for 60 min, stringent washes with SSC buffers at 57°C over 33 min followed by incubation of alkaline phosphatase-conjugated anti-FAM, NBT-BCIP substrate (all from Roche, Mannheim, Germany), and finally nuclear fast red counterstain (Vector Laboratories, Burlingname, CA, USA). Finally, all slides were dehydrated and the sections mounted with Eukitt (Electron Microscopy Sciences, Hatfield, PA, USA).
7
In Situ Hybridization of Murine Molars
8
LNA-ISH Analysis of NPC miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Locked nucleic acid (LNA) ISH on paraffin tissue sections was performed with a double 5′‐digoxigenin (DIG)‐labelled LNA probe specific for human miR‐4324, miR‐203a and miR‐199b‐5p (Exiqon, Woburn, MA, USA). 20 paraffin‐embedded sections came from 20 NPC patients (five in each NPC stage) were used for ISH analysis. First, paraffin‐embedded sections were deparaffinized in xylenes and then rehydrated through an ethanol dilution series. Slides were then treated with Proteinase K at 15 μg/ml for 10 min. at 37°C. Hybridization was performed at 54°C for the following: DIG labelled (U6) and double DIG (scrambled and miR‐4324, miR‐203a, miR‐199b‐5p), LNA‐modified oligonucleotide ISH probes. Positive probe labelling was blue/purple. Nuclei were visualized using Nuclear Fast Red counterstain (Vector Laboratories Inc., Burlingame, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!