Mirneasy isolation kit

MicroRNA profiling was performed across the LM-MEL panel of cell lines by small RNA sequencing at the Australian Genome Research Facility (AGRF) on the Illumina HiSeq platform using total RNA, including small RNAs, purified from cell line pellets using the Qiagen miRNEasy isolation kit, following the manufacturer’s recommendations (Qiagen, Chadstone, Victoria, Australia). Library preparation and 5’-barcode multiplexing were performed prior to sequencing; each sample was run in 3–4 sequencing lanes as required to achieve adequate sequencing depth. Initial read quality assessment and filtering were performed by AGRF. De-multiplexed raw read data and quality scores were provided in fastq format. All reads for each sample were concatenated using the UNIX command line and collapsed to single fasta format files using the FASTX-Toolkit (v. 0.0.13) command-line tool FASTQ Collapser. Collapsed reads were processed through the miRanalyzer webserver [93 (link)] to map reads to the genome using the hg18 build of the UCSC Homo sapiens genome, followed by mapping of miRs to miRBase [94 –99 (link)]. Raw and processed miR abundance data were deposited on the Gene Expression Omnibus (GEO; dataset GSE89438; Additional file 1). These data underwent normalisation and a log₂-transformation was performed (Fig. 6c).

MiRNA extraction was performed using miRNeasy isolation kit (Qiagen) with some modifications. Briefly, pelleted EVs obtained from 1 mL of PPP (from blood collected in EDTA tubes) were re-suspended in 200 μL double-filtered (0.2 μm) PBS. Qiazol solution (1 mL) was added and the sample was frozen at –80 °C at least overnight. The following day, after thawing, 5 fmol of cel-miR-39 spike-in (5′–3′ sequence: UCACCGGGUGUAAAUCAGCUUG, Sigma-Aldrich Israel) was added before the addition of 200 μL chloroform. After phase separation by centrifugation, glycogen (Roche Molecular Systems) was added as an RNA carrier. Isolation was performed according to the manufacturer’s instructions. The sample was eluted with 20 μL double-distilled water.

Total RNA was extracted using the Qiagen miRNeasy isolation kit according to the manufacturer’s instructions (Qiagen, Hilden, Germany). RNA concentration and quality was determined using 2 μL on a NanoDrop Spectro-photometer (ND-1000, Thermo Fisher). RNAs that passed the quality control test were reversely transcribed to cDNA with the use of High Capacity cDNA Reverse Transcription kit according to the manufacturer’s instructions (Applied Biosystems, Waltham, MA, USA). qPCR was performed using TaqMan® gene expression assays (Applied Biosystems, CA, USA) for measuring the expression of ZBTB16 (Hs00232313_m1), GR (Hs00353740_m1), SGK1 (Hs00353740_m1), PDX-1 (Hs00236830_m1) and INS (Hs02741908_m1) in Applied Biosystems QuantStudio (TM) 7 Flex RT-PCR system under default cycling parameters with. HPRT1 (4333768F) and PPIA (4333763F) were both used as endogenous controls. The ΔΔCt method was applied for relative quantification and the recalibrated values (2^−ΔΔCt) were presented as the fold-change with respect to control or untreated conditions.

Total RNA was extracted from APS treated and untreated OV-90 cells by miRNeasy isolation kit (Qiagen, Milan, Italy) according to the manufacturer’s protocol and the miRNA fraction was further purified by a mirVana miRNA isolation kit (Ambion, Austin, TX). miRCURY LNA™ microRNA Array with 1223 probes containing 3000 capture probes representing all human, mouse and rat microRNAs’ sequences were used to screen differentially expressed miRNAs between APS treated and untreated OV-90 cells. Total RNA (200 ng) was labeled using the miRCURY LNA™ Hy3™/Hy5™ Power labeling kit (Exiqon, Vedbaek, Denmark) and hybridized on the miRCURY™ LNA Array (v.16.0) (Exiqon) according to the manufacturer’s protocol. Microarray images were taken with a Genepix 4000B scanner (Axon Instruments, Foster City, CA, U.S.A.) and analyzed with Genepix Pro 6.0 software (Axon Instruments). Finally, the heat map of the 52 microRNAs most obvious differences was created using a method of hierarchical clustering by GeneSpring GX, version 7.3 (Agilent Technologies, California, United States). The threshold of screening differentially expressed miRNAs was set as a fold change >2.0 and a P-value <0.05. The microarray data that support the findings of the present study are available from the corresponding author upon reasonable request.

Bone marrow-derived DC were isolated and infected with different bacterial strains (H37Rv and H37RvΔTlyA) and cultured for 48 h for RNA isolation. Total RNA, including miRNAs, was isolated by miRNeasy isolation kit (Qiagen, Germany) according to the manufacturer's instructions. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON), and the reaction was set up according to the manufacturer's protocol. Real time quantitative RT-PCR analysis was performed using real-time thermal cycler (Bio-Rad) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR Green master mix (EXIQON, Vedbaek, Denmark) for miRNA amplification. Fluorescence data were collected at each amplification step. The relative expression level of miRNAs was normalized to that of internal control 5S rRNA by using 2-ΔΔCt cycle threshold method.