Superscript 2 rt kit

Total RNA was isolated using RNeasy Mini kit (Qiagen, Hilden, Germany) and cDNA synthesis was carried out using Superscript II RT kit (Invitrogen, Carlbad, CA, USA) according to the protocol previously described [48 (link)]. Expressions of specific genes were measured using human gene expression assays: VDR (Hs00172113_m1); SOCS1 (Hs00705164_s1); 18S rRNA (Hs99999901_s1)); and a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA).
miR-155 cDNA synthesis was carried out using either the TaqMan^®MicroRNA Reverse Transcription Kit or TaqMan Advanced miRNA cDNA synthesis kit (Applied Biosystems, USA) according to the manufacturer’s protocol. In liver tissue, the expression of miR-155 (002623) and reference microRNA, RNU44 (001091) were measured using TaqMan^® miRNA assays and TaqMan^® Universal PCR Master Mix No AmpErase (Applied Biosystems, USA). In PBMCs the expression of miR-155 (477927_mir) and reference microRNA, miR-191 (477952_mir) were measured using TaqMan^® Advanced miRNA assays and TaqMan^® Fast Advanced Master Mix (Applied Biosystems, USA). The fluorescence data were analyzed with 7500 Software v2.0.2. (Applied Biosystems, USA) and expressions of target genes were calculated using the ΔΔCt method of relative quantification.

Total RNA was isolated from frozen tissue samples and cultured cells using TRIzol (Invitrogen) following the manufacturer’s instructions. Reverse transcription was carried out with 2 μg of total RNA from each sample using the SuperScript II RT kit (Invitrogen). Quantitative real-time PCR was conducted using SYBR Green PCR master mix (Applied Biosystems, Foster City, CA, USA) on an ABI 7500HT System (Applied Biosystems). The specific primer sequences for PCR were as follows: USP22, 5'-GACCAGATCTTCACAGGCGG-3' (forward) and 5'-GCAGACTTGGCAGGTGACGT-3' (reverse); MDMX, 5'-GCCTTGAGGAAGGATTGGTA-3' (forward) and 5'-TCGACAATCAGGGACATCAT-3' (reverse); β-actin, 5'-GAGCACAGAGCCTCGCCTTT-3' (forward) and 5'-AGAGGCGTACAGGGATAGCA-3' (reverse). The relative mRNA expression was calculated by the ^ΔΔC_t method.

Total RNA was extracted from the mouse and human melanoma cells using the Trizol reagent (Invitrogen), and cDNA was transcribed using a SuperScript II RT kit (Invitrogen), both according to the manufacturers’ instructions. Expression levels of each gene were determined by reverse-transcription PCR using specific primers, and mRNA levels in each sample were normalized to the relative quantity of β-actin gene expression. All experiments were performed in triplicate. The specific primers used for mouse and human metabolic genes are listed in Supplementary Table S1. All primers were purchased from Integrated DNA Technologies.

Total RNA was extracted from tissues using the RNeasy kit (QIAGEN ®). Samples from the following tissues were used: liver from a healthy dog (Dp71 expression positive control), biceps femoris muscle from a healthy dog, a GRMD dog and a LRMD dog (LRMD8) and sartorius cranialis, tibialis cranialis muscles from a LRMD dog (LRMD8). Reverse transcription was performed using the Superscript II RT kit (Invitrogen®). cDNA concentration was determined by spectrophotometry (Nanodrop). PCR was performed on 120 ng of each of the 7 cDNA samples using the Phusion high fidelity DNA polymerase (Thermo Scientific ®). The forward primer was designed to bind to the junction of the first specific exon of the Dp71 transcript and the exon 63 of the Dp427 transcript (exon 2 of the Dp71), the reverse primer was designed to bind to the junction between exons 64 and 65 of the Dp427 transcript (exons 3–4 of the Dp71) based on published canine sequences AY566609 and ENSCAFT00000036277 (Sequences in Table S1). The expected size of the PCR product was 164 bp.

The stool sample was diluted to approximately 10% with phosphate-buffered saline. This suspension was vortexed and then centrifuged at 3,000 × g for 10 min. RNA was extracted from 250 μl of the clarified supernatant using 750 μl of TRIzol LS (Life Technologies), as recommended. RNA was then extracted using a QIAamp Viral RNA Mini kit (Qiagen). cDNA was made using 10 μl of RNA and a Superscript II RT kit (Invitrogen) as recommended. The cDNA was digested with 0.01 μg of RNase (DNase free; Roche) and then purified with a QIAquick PCR purification kit (Qiagen) and amplified by PCR using primers targeting the 5-prime (VEE-NV5ʹ, AGTCTAGTCCGCCAAGATGAAGATGGCGTCGAATGAC) and 3-prime (NV3ʹAscI, NNNNNNGGCGCGCCTTATAATGCACGTCTACGCCC) ends of ORF2. The amplicons were cloned into Tope XL (Invitrogen), and 12 colonies were selected and sequenced. GII.4 MC4 represents the consensus sequence of the 12 clones, and MC12 represents the strain with the most divergent sequence. Capsid genes were synthesized by Bio-Basic, Inc. (Amherst, NY). VLPs were expressed in baby hamster kidney cells (ATCC CCL-10) from Venezuelan equine encephalitis virus replicons expressing norovirus open reading frame 2 (NoV ORF2), as described previously (17 (link), 35 , 36 (link)). Particle integrity was confirmed by electron microscopy visualization of negative-stained particles of ∼40 nm.

Thymuses were homogenized with the FastPrep FP120 instrument (Qbiogen, Illkirch, France). Total RNA was prepared from the thymus and TECs using the trizol RNA Isolation kit (Invitrogen, Cergy-Pontoise, France). The quality and concentration of RNA were analyzed with a NanoDrop ND-1000 spectrophotometer (LabTech, Palaiseau, France). RNA samples presenting a minimal ratio of 1.9 and 2 for respectively 260/280 and 260/230 were also controlled on a denaturing agarose gel. When the samples were degraded even partially, they were excluded. Total mRNA (1 μg) was reverse-transcribed using the SuperScript II RT kit (Invitrogen Cergy-Pontoise, France) according to the manufacturer’s instructions.