Log In Sign up
The largest database of trusted experimental protocols

Translation blocking antisense morpholino oligonucleotides

Manufactured by Gene Tools
Visit Supplier

Translation-blocking antisense morpholino oligonucleotides are synthetic molecules designed to bind to and block the translation of specific target mRNA sequences. They function by sterically hindering the ribosome from accessing the translation initiation site, thereby preventing protein synthesis.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Morpholino antisense oligonucleotides Translation-blocking morpholino Antisense morpholinos Morpholino oligonucleotides Morpholinos Oligonucleotide

2 protocols using translation blocking antisense morpholino oligonucleotides

1

Morpholino Knockdown of NvecGrl1 in Cnidarians

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Translation-blocking antisense morpholino oligonucleotides (GeneTools, LLC) were designed to match the sequence of NvecGrl1. The sequences of the morpholinos used are:
NvecGrl1#1: ACGCTCCGACTGGAACTGCCATTCA
NvecGrl1#2: GAACTGCCATTCATTCCGCTTGTTC
control#1 (generic;36 (link)): CCATTGTGAAGTTAAACGATAGATC
control#2 (NvecGrl1 mismatch): ACGCGCCTACTGGAATTGCTATTAA
The two morpholinos against NvecGrl1 are partially overlapping to avoid 5′UTR sequence that is present elsewhere in the genome. The sequence corresponding to the start codon in the NvecGrl1 morpholinos is underlined.
Six3/6: GTACTGCCGCACTGCAAGACTTGTC36 (link)Fgfa1: ATAAGGTGGACGCATGACTTTGTAG
Fgfa2: CGTTAGCATGGTGATCGTCATGTTG33 (link)
Saina M., Busengdal H., Sinigaglia C., Petrone L., Oliveri P., Rentzsch F, & Benton R. (2015). A cnidarian homologue of an insect gustatory receptor functions in developmental body patterning. Nature communications, 6, 6243.
+ Open protocol
+ Expand
2

Morpholino Knockdown of NvecGrl1 in Cnidarians

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Translation-blocking antisense morpholino oligonucleotides (GeneTools, LLC) were designed to match the sequence of NvecGrl1. The sequences of the morpholinos used are:
NvecGrl1#1: ACGCTCCGACTGGAACTGCCATTCA
NvecGrl1#2: GAACTGCCATTCATTCCGCTTGTTC
control#1 (generic;36 (link)): CCATTGTGAAGTTAAACGATAGATC
control#2 (NvecGrl1 mismatch): ACGCGCCTACTGGAATTGCTATTAA
The two morpholinos against NvecGrl1 are partially overlapping to avoid 5′UTR sequence that is present elsewhere in the genome. The sequence corresponding to the start codon in the NvecGrl1 morpholinos is underlined.
Six3/6: GTACTGCCGCACTGCAAGACTTGTC36 (link)Fgfa1: ATAAGGTGGACGCATGACTTTGTAG
Fgfa2: CGTTAGCATGGTGATCGTCATGTTG33 (link)
Saina M., Busengdal H., Sinigaglia C., Petrone L., Oliveri P., Rentzsch F, & Benton R. (2015). A cnidarian homologue of an insect gustatory receptor functions in developmental body patterning. Nature communications, 6, 6243.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!