Cfx96tm real time pcr detection system

Total RNAs were isolated using Trizol Reagent (Invitrogen, USA) and reverse transcribed into cDNA using iScript^TM cDNA synthesis kit (Bio-Rad, USA). For detection the mRNA level of PTEN, the RT product was subjected to 40 cycles of quantitative PCR with Takara SYBR Premix Ex Taq^TM (Tli RNaseH Plus, Japan) in CFX96^TM Real-Time PCR Detection System (Bio-Rad, USA). 18s was used as an internal reference. The primer sequences (forward and reverse) are as follows: PTEN, CAATGTTCAGTGGCGAACTT and GGCAATGGCTGAGGGAACT; 18s, ATTC GAACGTCTGCCCTATCAA and CGGGAGTGGGTAATTTGCG. For quantitative miRNA analysis, Bulge-Loop™ miRNA qPCR Primer Set (RiboBio, China) was used to detect miRNA expression levels with Takara SYBR Premix Ex Taq^TM (Tli RNaseH Plus, Japan) by qRT-PCR in CFX96^TM Real-Time PCR Detection System. 5s was used for normalization of miRNA expression levels. The relative expression levels for each mRNA and miRNAs were calculated by the 2^−ΔΔCTmethod.

Isolation of total RNA was performed using Trizol reagent (Invitrogen, Paisley, UK). For mRNA analysis, a total of 400 ng RNA was used for cDNA synthesis using Bio‐Rad iScripTM cDNA Synthesis Kit (Bio‐Rad, Richmond, CA, USA). PCR amplification was carried out with Takara SYBR Premix Ex Taq^™ (Tli RNaseH Plus, Takara, Kusatsu, Japan) in CFX96TM Real‐Time PCR Detection System (Bio‐Rad). β‐actin was used as internal control. For miRNA analysis, the Bulge‐LoopTM miRNA qPCR Primer Set (RiboBio) was used to detect miR‐212 expression by qRT‐PCR with Takara SYBR Premix Ex Taq^™ in CFX96TM Real‐Time PCR Detection System. U6 and 5s were used as internal controls for in vivo and in vitro experiments, respectively. The utilized primers were listed in Table 1.