Mir 101 3p mimic

MiR-101-3p mimics, inhibitors or negative controls were designed from RiboBio Co., Ltd Company (Guangzhou, China). AGT4D siRNA and Negative control was purchased from Santa Cruz. According to the instruction, lipofectamine 2000 (Invitrogen, USA) was used for transfection. The relative sequence is shown in Table 1.Table 1.

The primer sequences are as follows

Name	Sequence
NC siRNA	5′- ATCCCCGAACGUGACACGUAT −3′
AGT4D siRNANC mimicsNC inhibitor	5′- CGGACCAGCUUUAGCAAGA −3′5ʹ- CAGUACUUUUGUGUAGUACAA −3ʹ5ʹ- UUCUCCGAACGUGUCACGUTT −3ʹ
miR-101-3p mimics	5′- UACAGUACUGUGAUAACUGA −3′
miR-101-3p inhibitor	5′- UCAGUUAUCACAGUACUGUA −3′

The schematic diagram of design and method of this study was presented in Figure S1. Doxorubicin liposomes (DOX‐L) were synthesized by methods described in literatures previously 22. MiR‐101‐3p mimics and the negative control miR‐NC were synthesised by Guangzhou Ribobio Company (Guangzhou, China). To prepare miR‐101/DOX‐L, DOX‐L and miR‐101‐3p were mixed at w/w (weight DOX‐L/weight microRNA) ratio of more than 200:1 in RNase‐free H₂O by adding a stock solution of DOX‐L into a miR‐101‐3p solution. The samples were vortexed for 2–3 min and then incubated at room temperature for 30 min to ensure formation of miR‐101/DOX‐L nanoparticles (Fig. S2). L, DOX‐L, and miR‐101/DOX‐L were characterized by UV‐Vis spectrophotometry and dynamic light scattering (DLS). Cellular uptake assay, TaqMan qRT‐PCR, SYBR Green qRT‐PCR, wound‐healing assay, cell proliferation, migration/invasion, apoptosis, clonogenicity assay, and western blot analysis were performed as described previously 7, and detailed in Data S1. The primer sequences used in SYBR Green qRT‐PCR are listed in Table S2.

The miR-101-3p inhibitor, miR-101-3p mimic, and their corresponding negative control (NC) were purchased from RiboBio (Guangzhou, China); EIF4G2-siRNA and its corresponding NC were purchased from Genechem Co., Ltd. (Shanghai, China). NPCs in the logarithmic phase were seeded into the 6-well plates (2 × 10⁵ cells/well) and cultured for 24 h. Then, cell transfection was performed using Lipofectamine 2000 (siRNA 10–100 nM and miRNA mimic 50 nM). The subsequent experiments were conducted after 48 h.

The NEAT1 knockdown (sh-NEAT1) plasmid, NEAT1 over-expression (OE-NEAT1) plasmid and the corresponding negative control (sh-NC), as well as the miR-101-3p mimic, miR-101-3p inhibitor and the corresponding negative control were synthesized (Ribobio, Guangzhou, China). The EMP2 full-length (with 3’-UTR) plasmid, EMP2 mutated plasmid (with 3’-UTR), and the negative controls were synthesized (Life technology, Carlsbad, CA, USA). The lipofectamine 2000 reagent (Life Technologies Corporation, Carlsbad, CA, USA) was used for the cells transfection according to the manufacturer’s instructions. The plasmid carrying a non-targeting sequence was used as a negative control (NC) of NEAT1 which were referred as to sh-NC. The stably transfected cells were selected by the culture medium containing 0.5 mg/ml G418 (Sigma-Aldrich, St Louis, MO, USA). After approximately 4 weeks, G418-resistant cell clones were established. miR-101-3p mimics, inhibitors and their respective NC were synthesized (Life Technologies Corporation, MD, USA) and transfected into cells in the in vitro study. Because the highest transfection efficiency was occurred at 48 h, thus 72 h post-transfection was considered as the harvest time in the subsequent experiments.

Short hairpin RNAs (shRNAs) for PLK2 and SKP1, overexpression plasmids for PLK2 and α-Syn (pcDNA3.1-α-Syn), and corresponding negative controls were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). miR-101-3p mimic, inhibitor, and negative control were purchased from RiboBio (Guangzhou, China). Transfection was conducted according to the instruction of the manufacturer.