Fluorescence quantitative pcr instrument

Eight genes involved in the immune response were selected for RT-qPCR analysis to confirm the reliability of the RNA-seq data. Spleen samples from the two groups before and after GCRV infection were obtained, and RNA samples were prepared. First-strand cDNA was obtained using a random hexamer primer and ReverTra Ace kit (Toyobo, Japan). RT-qPCR was performed using a fluorescence quantitative PCR instrument (Bio-Rad, USA). Each RT-qPCR mixture contained 0.8 μL forward and reverse primers (for each primer), 1 μL template, 10 μL 2× SYBRgreen master mix (TOYOBO, Japan), and 7.4 μL ddH2O. Three replicates were included for each sample, and the β-actin gene was used as an internal control for normalization of gene expression. The relative expression levels of genes in the TYO group were calculated as the ratio of gene expression levels relative to those in the FMO group at the corresponding time point. The primers are listed in Table S1. The RT-qPCR program was as follows: 95°C for 10 s, 40 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 30 s, followed by melt curve construction. Relative expression levels were calculated using the 2^-△△Ct method (20 (link)). Data represent the mean ± standard deviation of three replicates.

The primer sequences are shown in Table 2. Total mRNA was extracted from the prefrontal and striatum using Trizol, and RNA concentration and purity were detected at 260 and 280 nm by ultra-micro spectrophotometer (Piñero et al., 2020 (link)). ®RT first strand cDNA synthesis kit was used to reverse transcribe RNA to cDNA. The following conditions were applied: 25°C for 5 min, 42°C for 30 min, and 85°C for 5 s. PCR amplification conditions were: 95°C for the 30 s, 95°C for 15s, 60°C for 30 s, 40 cycles. Fluorescence quantitative PCR instrument (Bio-rad) output the experimental results, while 2^-△△Ct algorithm was used to analyze the relative expression of PFC and striatal PKA, DRD1, and DRD2 mRNA.

The total RNA of the cells was extracted using TRIzol reagent (Thermo Fisher Scientific, USA), per the manufacturer’s instructions. Isolated RNA samples were qualitatively and quantitatively assessed using the NanoDrop Microvolume Spectrophotometers (Thermo Fisher Scientific, USA) at 260/280 nm. The reverse transcription reaction was performed using ReverTra Ace qPCR RT Kit (Toyobo, Japan). Real-time qPCR (RT-qPCR) was carried out using 2×SYBR Green qPCR Mix (With ROX) (Sparkjade, China) and a fluorescence quantitative PCR instrument (Bio-rad, USA). The relative expression of the bub1 mRNA was calculated using the 2-ΔΔCT method and GAPDH as an endogenous control. The primers used for RT-qPCR were synthesized by Sangon Biotech (Shanghai) and listed below:
bub1 forward primer, 5’-GAAAGCATGAGCAATGGGTAAA-3’;
bub1 reverse primer, 5’- CCACCTGATGCAACTTCTTATG-3’;
GAPDH forward primer, 5’-GTCTCCTCTGACTTCAACAGCG-3’;
GAPDH reverse primer, 5’-ACCACCCTGTTGCTGTAGCCAA-3’.

The S. aureus biofilm was cultured under the condition of QEN concentrations of 0, 64, 128, and 256 µg/mL. The Trizol method was used to extract the total RNA from the biofilm cultured in a 90-mm petri dish for 40 h, and qPCR was performed using a Bio-rad fluorescence quantitative PCR instrument after reverse transcription. The results were calculated using the 2^−ΔΔCt method (Table 2).

In order to verify the accuracy of RNA-Seq. Fisrtly, we using PrimeScript^TM reagent kit with gDNA Eraser (TAKARA RR047A) and PCR instrument (Bio-Rad) to reverse transcription reaction, according to the instructions. Then, we using TB Green Premix Ex Taq^TM II (TAKARA RR820A) and Fluorescence quantitative PCR instrument (Bio-Rad) to detect the RNA expression level, according to the instructions.The RT-qPCR was used to investigate the relative levels of DE RNAs. The primers for those DE RNAs and GAPDH are shown in Table S1. MicroRNAs needs to replace the random primers in Takara RR047A with specific primers (Table S1) for specific stem ring detection to reverse transcription reaction.

The expression of MST-4 and TRAF-6 was measured using RT-PCR. Total RNA was extracted from PBMCs. cDNA was synthesized using an RT Reagent Kit (TaKaRa, Japan). The primer sequences are shown in Table 1. The following program was run for 40 cycles: 95 °C, 30 s; 95 °C, 5 s; 60 °C, 30 s. The reactions contained the following reagent proportions: 5 μl SYBR® Premix Ex Taq II (Tli RNaseH Plus) (2 ×), 1 μl upstream primer, 1 μl downstream primer, 1 μl cDNA, and 2 μl RNase-free dH₂O. The threshold cycle (cycle threshold, Ct) was obtained with a fluorescence quantitative PCR instrument (Bio-Rad, USA). The relative levels of MST-4 and TRAF-6 mRNA were calculated using the 2-ΔΔCt method and were normalized to the corresponding β-actin values.Table 1

Primer sequences used for the real-time PCR

Primer	Sequences	bp
MST-4	F 5′ TGAGGAAGCCGAAGATGAAATAG 3′R 5′ CCAGCTCGAAGAAGATCCAGTG 3′	170
TRAF-6	F 5′ GGATTCTACACTGGCAAACCCG 3′R 5′ CCAAGGGAGGTGGCTGTCATA 3′	137
β-actin	F 5′ CCACGAAACTACCTTCAACTCC 3′R 5′ GTGATCTCCTTCTGCATCCTGT 3′	132