The full-length coding cDNA fragment (261 bp) of HIV-1IIIB Tat1-86 mRNA and the C-terminal coding cDNA fragment (432 bp) of mouse EndoG mRNA were prepared by PCR with the primers indicated in Table 1 , while the C-terminal coding cDNA fragment (423 bp) of firefly luciferase mRNA was provided with the pGEM-T-easy vector system (Promega; Madison, WI, USA); these cDNA fragments were cloned into the pGEM-T-easy vector. The insert and direction in the resulting plasmids were confirmed by sequencing, and plasmid DNA was prepared using the Hipure Plasmid Filter Midiprep Kit (Invitrogen; Grand Island, NY, USA). Plasmids were linearized by restriction enzyme digestion, and in vitro transcription was performed to produce sense messenger RNA followed by covalently conjugating the Alexa Fluor® 594 fluorescent dye to the mRNAs using the FISH Tag™ RNA Red Kit (Invitrogen; catalog F32954) according to the manufacturer’s instructions.
Fish tag rna red kit
Manufactured by Thermo Fisher Scientific
The FISH Tag™ RNA Red Kit is a fluorescence in situ hybridization (FISH) product designed for the detection and visualization of target RNA molecules within cells or tissue samples. The kit provides the necessary reagents and protocols for labeling RNA targets with a red fluorescent probe.
Automatically generated - may contain errors
Lab products found in correlation
Pgem t easy vector, by Promega (2 mentions)
Hipure plasmid filter midiprep kit, by Thermo Fisher Scientific (1 mentions)
Pgem t easy vector system, by Promega (1 mentions)
Alexa fluor 594 dye, by Thermo Fisher Scientific (1 mentions)
Tween 20, by Merck Group (1 mentions)
Bovine serum albumin (bsa), by Merck Group (1 mentions)
Dmi8 inverted microscope, by Leica (1 mentions)
Plan apochromat, by Zeiss (1 mentions)
Hard set mounting medium with dapi, by Vector Laboratories (1 mentions)
Alexa fluor 594, by Thermo Fisher Scientific (1 mentions)
Power sybr green cells to ct kit, by Thermo Fisher Scientific (1 mentions)
Bx51wi microscope, by Olympus (1 mentions)
5 protocols using fish tag rna red kit
1
Labeling mRNA with Alexa Fluor 594 Dye
2
LINC00273 Localization and NEDD4 Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Fluorescence in situ hybridization (FISH) labeling, LINC00273 probe (GenePharma) was fluorescence‐labeled using FISH Tag™ RNA Red Kit with Alexa Fluor® 594 dye (red; Invitrogen). A549 cells, which had been transfected with pcDNA3.1/LINC00273, were incubated with denatured probe (at 80℃ for 2 min) in hybridization buffer at 55℃ overnight. Next, for immunofluorescence labeling, cells were rinsed with PBS, immobilized with paraformaldehyde, permeabilized with Triton X‐100 and blocked with 1% bovine serum albumin (BSA; Sigma‐Aldrich) for 30 min. Subsequently, cells were incubated with NEDD4 antibody (Invitrogen), 1% BSA, and 0.1% Tween 20 (Sigma‐Aldrich) in PBS at 4℃ overnight. Alexa Fluor® 488‐conjugated goat polyclonal anti‐rabbit IgG (green; Abcam) secondary antibody was then applied at 37℃ for 1 h of incubation. DAPI was used for nuclear staining. Cells were observed using a Leica DMi8 inverted microscope (Leica Microsystems).
3
Subcellular Localization of GATA2-AS1 in CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the subcellular distribution of GATA2-AS1 in CRC cells, FISH assay was carried out utilizing FISH Tag™ RNA Red Kit (F32952, Invitrogen) as per the user guide. Cells were fixed and washed, followed by incubation with FISH probe specific for GATA2-AS1 (5 μL; RiboBio, Guangzhou, China) in hybridization buffer. Nuclear counterstain was done utilizing DAPI. The slides were observed with a fluorescence microscope. The experiment was done in triplicate.
4
Immunofluorescence and RNA-FISH Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following fixation and permeabilization (20 min in 4% paraformaldehyde at RT, followed by 15 min immersion in MeOH −20 °C), fixed cells were incubated with primary antibodies diluted in blocking buffer for 18 h at 4 °C. After washing with phosphate-buffered saline, cells were incubated with secondary antibodies conjugated with Alexa Fluor dye for 1 h at RT, washed in phosphate-buffered saline and mounted using HardSet mounting medium with DAPI (Vector Laboratories, Burlingame, CA, USA). RNA-FISH was performed as described.42 FAS sense and antisense fluorescent RNA probes were generated using the FISH tag RNA red kit with Alexa Fluor 594 (Invitrogen) and the primers FAS-forward-sense (5′-ATTTAGGTGACACTATAGAAGATCCTACCTCTGGTTCTTACGTCTG-3′) or FAS-reverse-antisense (5′-TAATACGACTCACTATAGGGAGTTAGATCTGGATCCTTCCTCTTT -3′), respectively. Images were collected using an Axioplan II imaging (Carl Zeiss, Jena, Germany) microscope equipped with a 63/1.40 immersion objective (Plan-Apochromat, Carl Zeiss).
5
Fluorescent in situ Hybridization of CR45362 in Drosophila Testes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from WT 3–5-day old flies was extracted and reverse transcribed to cDNA using Power SYBR Green Cells-to-Ct Kit (Invitrogen# 4402953) following manufacturer’s protocol. CR45362 template was generated following manufacturers protocol by PCR Amplification using DreamTaq DNA Polymerase with buffer (Thermo Scientific# EP0701), 10 mM dNTPs (Sigma Aldrich# DNTP100-KT), 5 pmol/ul custom primers (GTCGGGACGGAATGAGAGTG and GAGCGAGCCACTTGAGCATA), and ∼1 ug of total cDNA from above. Products were then ligated into pGEM-T Easy Vector (Promega# A1360). Plasmids were linearized for fluorescent probe production using Invitrogen FISH tag RNA Red Kit (Invitrogen# F32954). Dissected testis was incubated with fluorescent probes following manufacturer’s protocol, and imaged with an epifluorescence-equipped Olympus BX51WI microscope.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!