Anti b220 pe

Spleens and inguinal lymph nodes were collected and single-cell suspensions were generated in IMDM 10% FCS Pen-Strep. Cells were surface stained to quantify cell populations. T cell panel: anti-CD3 Alexa 700 (BioLegend; clone 17A2), anti-CD4 PE-Cy7 (BioLegend; clone RM4-5), anti-CD8 V500 (BD Horizon, clone 53-6.7), anti-CD62L APC (BD Pharmingen; clone MEL-14), anti-CD44 Pacific Blue (clone IM7, grown in-house), anti-CXCR5 PE (BioLegend; clone J252D4), and anti-CCR7 PerCP (BioLegend; clone 4B12). B cell panel: anti-B220 PE (BioLegend; clone RA3-6B2), anti-CD38 APC (BioLegend; clone 90), anti-Fas PE-Cy7 (BioLegend; clone Jo2), anti-GL7 FITC (BioLegend; clone GL7), anti-MHCII Pacific Blue (BioLegend; clone M5/114.15.2), anti-CD19 Alexa 700 (BioLegend; clone 6D5), and anti-CD138 Percp (BioLegend; clone 281-2). CD4⁺ T_CM were CD3⁺CD4⁺CD44^highCD62^high, CD4⁺ T_EM were CD3⁺CD4⁺CD44^highCD62L^low, T follicular helper cells (T_FH) were CD3⁺CD4⁺CXCR5⁺, germinal center (GC) B cells were B220⁺CD19⁺GL7⁺Fas⁺, and plasma cells B220⁺CD19⁺CD138⁺CD38⁺.

Single cell suspensions from the spleen, lymph node and thymus were prepared and stained after a washing step for surface marker expression with the following fluorochrome conjugated antibodies: anti-CD3-PECy7, anti-CD4-FITC, anti-CD8-APC and anti-B220-PE, (all from Biolegend). For the staining of activation markers, cells were pre-activated for 24 h with stimulating antibodies (aCD3 and aCD28) and then stained with the following antibodies: anti-CD25-APC, anti-CD44-PECy7 and anti-CD69-PE (all from Biolegend). For analyses of thymocytes the following antibodies were used: anti-CD24-FITC, anti-CD5-PerCP Cy5.5 and TCRβ-Pe Cy7 (all from Biolegend).
For the staining of intracellular FoxP3, the cells were fixed and subsequently permeabilized to the staining of surface antigens. The FoxP3 FITC staining buffer set (eBioscience) was used for the detection of Foxp3. Data were acquired on a FACSCalibur (CellQuest, BD Biosciences) and analyzed with FlowLogic software (eBioscience).

Antibodies for flow cytometry, anti-Kit-APC, anti-Mac-1-APC, anti-Gr-1-PE, anti-CD3-APC, and anti-B220-PE, were purchased from BioLegend and used as described [1 (link)]. The manufacturers and catalog numbers for other antibodies and reagents are as follows: anti-PirB-PE, R&D Systems, FAB2754P; pCAMKI, Santa Cruz, sc-28438; anti-pCAMKII, Abcam, ab32678; anti-pCAMKIV, Santa Cruz Biotechnology, sc-28443-R; anti-CAMKI, Abcam, ab68234; anti-CAMKII, Cell Signaling, 4436; anti-CAMKIV, Cell Signaling, 4032; anti-pCREB, Cell Signaling, 9198S; anti-CREB, Cell Signaling, 9197S; anti-actin, Sigma Aldrich, A2066; STO-609, Sigma Aldrich, S1318; KN93, Sigma Aldrich, K1385; The PCR primer sequences were as follows: hCAMKI forward: CGGAGGACA TTAGAGACA, reverse: CTCGTCATAGAAGGGAGG-3; hCAMKIV forward: GATGAAAGAGGCGATCAG, reverse: TAGGCCCTCCTCTAGTTC. PirB forward: GAG AATCACCAGACACATGC, PirB reverse: CTGCCCTCATGTCTTAACTT, mCAMKIV forward: AAGCAGGCGGAAGACATTAGG, CAMKIV reverse: AGTTTCTGAGTCCTCTTGTCCT.

We performed flow cytometry, immunohistochemistry, and cytospin as described previously [1 (link), 15 (link), 16 (link)]. For flow cytometry analysis of AML cells, peripheral blood or BM cells were stained with anti-Mac-1-APC, anti-Gr-1-PE, anti-CD3-APC, anti-B220-PE, or anti-Kit-PE monoclonal antibodies (BioLegend). For analysis of apoptosis, indicated AML cells were stained with PE-conjugated anti-annexin V and 7-AAD (BD Pharmingen) according to the manufacturer’s instructions.