Pgl4.10 reporter plasmid

The three cloned LH-beta promoter fragments were cut from the pCR^®2.1-TOPO^® vector (Invitrogen) using kpnI and SacI restriction enzymes and inserted into the pGL4.10 reporter plasmid (Promega). All sequences were verified both by restriction digestion analysis and direct sequencing. Sequencing was performed on both strands using a commercial sequencing service (Seqlab, Goettingen, Germany).

For Western blot and cytometry assays, the two missense variants under study, NM_000527.5:c.1A>T and NM_000527.5:c.1A>C, were individually introduced into the human LDLR cDNA (NM_000527.5) in the mammalian expression vector pcDNA3 under control of an SV40 promoter and enhancer. For luminometry assays, the promoter and the 5′ untranslated region (5′UTR) of LDLR (−319 bp upstream from ATG) were cloned upstream the Firefly Luciferase (FLuc) coding region in the pGL4.10 reporter plasmid (Promega, Madison, WI, USA), obtaining the LDLR_pGL4-WT construct. Both plasmids were subjected to oligonucleotide site-directed mutagenesis using the NZYMutagenesis kit (NZYTech, Lisbon, Portugal), according to the manufacturer’s instructions. For every variant, the presence of the correct variant and the integrity of the region was confirmed by direct Sanger sequencing.

The FN1's promoter sequence was first amplified by PCR using forward primer (5′-3′CGCTCGAGTTCAGTGCAGTAAATATATC) and
reverse primer (5′-3′ ATGATATCTGGGACGGTCCCC
TCCCGCC), and cloned to the XhoI/EcoRV sites of pGL4.10 reporter plasmid (Promega, USA). The PDGFRB's promoter sequence was amplified using forward primer (5′-3′ ATCTCGAGACTCTTATGGTCCCCAACCCGT) and reverse primer (5′-3′ ATAGATCTCCAGATAGGGCGGG
CAGTCA), and cloned into XhoI/BglII sites of pGL4.10 plasmid. After 36 hours of STAB1 transfection, Firefly luciferase and Renilla luciferase were quantified with the Dual-Luciferase Reporter Assay system and the Stop & Glo Reagent kit according to the manufacturer's instruction (Promega, USA).