The largest database of trusted experimental protocols

Phix174 dna hinfi marker

Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom

The PhiX174 DNA/HinfI Marker is a DNA molecular weight marker used for size determination of DNA fragments in agarose gel electrophoresis. The marker consists of DNA fragments of known sizes derived from the bacteriophage PhiX174 genome and digested with the restriction enzyme HinfI.

Automatically generated - may contain errors

2 protocols using phix174 dna hinfi marker

1

Quantifying Sulfide Quinone Reductase Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from homogenates of freshly isolated rat PAs, mesenteric arteries, aorta, brain, and cultured PASMCs. Reverse transcription of the RNA was carried out as previously described (16 (link)). RT-PCR primer pairs for rat sulfide quinone reductase-like (SQRDL) were designed using Primer3web version 4.0 (http://primer3.ut.ee) and synthesized by Sigma-Aldrich (St. Louis, MO). SQRDL (Accession No. BC158559) primers were sense CTGCAGGACTTCAAGGAAGG and antisense CTCTCCCGAATGATCTCCTG. PCR was carried out using PuReTaq Ready-To-Go PCR Beads (GE Healthcare, Piscataway, NJ), and the PCR products (reaction equivalent on 20 ng reverse transcribed RNA) were analyzed by electrophoresis on 2.8% agarose gels run in TAE buffer (National Diagnostics, Hessle, UK) with PhiX174 DNA/HinfI Marker (Thermoscientific, Waltham, MA).
+ Open protocol
+ Expand
2

Reverse Transcription and RT-PCR Analysis of Rat IPA

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from homogenates of freshly isolated rat IPAs and reverse transcription carried out as previously described (Knock et al. 2008 (link)). RT-PCR primer pairs were designed using Primer3web version 4.0 (http://primer3.ut.ee) and synthesized by Sigma-Aldrich (St Louis, MO, USA). MPT (accession no. NM_138843): sense CCTTCATCAAGACCCACGAG, antisense TGGACAGGTCCACCTTCTTC; CβS (accession no. NM_012522): sense ATGCTGCAGAAAGGCTTCAT, antisense CAACACCAAACACCATCAG; CγL (accession no. NM_017074): sense GGTTTTGTATACAGCCGCTCTGG, antisense TGCAAATGACTTCATCTCCTGCT. PCR was carried out using PuReTaq Ready-To-Go PCR Beads (GE Healthcare, Piscataway, NJ, USA) and the PCR products (reaction equivalent on 20 ng reverse transcribed RNA) were analysed by electrophoresis on 2.8% agarose gels run in TAE buffer (National Diagnostics, Hessle, UK) with PhiX174 DNA/HinfI Marker (Thermoscientific Inc., Waltham, MA, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!