48 capillary array 3730 dna analyzer

The total genomic DNA was extracted followed by QIAamp DNA Mini Kit standard protocol. The published primer pair, FishF1-5′TCAACCAACCACAAAGACATTGGCAC3′ and FishR1-5′TAGACTTCTGGGTGGCCAAAGAATCA3′ (Ward et al. 2005 (link)) was used for amplification of partial mitochondrial cytochrome c oxidase subunit I (mtCOI) (∼650 bp) gene segment in a Veriti^® Thermal Cycler (Applied Bio systems, Foster City, CA). The 25 µl PCR mixture contains 10 pmol of each primer, 100 ng of DNA template, 1 × PCR buffer, 1.0–1.5 mM of MgCl2, 0.25 mM of each dNTPs, and 0.25 U of Platinum Taq DNA Polymerase High fidelity (Invitrogen, Life Science Technologies). PCR conditions were: initial denaturation at 94 °C (2 min) followed by 30 cycles at 94 °C (45 s), 50 °C (45 s), and 72 °C (1 min), and a final elongation at 72 °C (8 min). The PCR amplified products were checked in 1% agarose gel containing ethidium bromide (10 mg/ml). Further, the PCR products were purified using QIAquickR Gel extraction kit (QIAGEN Inc., Germantown, MD), and cycle sequencing products were cleaned by using standard BigDye X Terminator Purification Kit (Applied Biosystems, Foster City, CA). Sequencing was done bi-directionally in 48 capillary array 3730 DNA Analyzer (Applied Biosystems, Foster City, CA) following Sanger sequencing methods.